La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

17 dicembre 2010 Trento Linguaggi sovrapposti: il codice dello splicing Piva F, Giulietti M, Principato G Department of Biochemistry, Biology and Genetic.

Presentazioni simili


Presentazione sul tema: "17 dicembre 2010 Trento Linguaggi sovrapposti: il codice dello splicing Piva F, Giulietti M, Principato G Department of Biochemistry, Biology and Genetic."— Transcript della presentazione:

1 17 dicembre 2010 Trento Linguaggi sovrapposti: il codice dello splicing Piva F, Giulietti M, Principato G Department of Biochemistry, Biology and Genetic Politechnic University of Marche, Ancona

2 Binding of DAZAP1 and hnRNPA1/A2 to an Exonic Splicing Silencer in a Natural BRCA1 Exon 18 Mutant Goina E, Skoko N, Pagani F. Mol Cell Biol 2008; 28: 3850–3860 One point mutation at a time BRCA1 exon % 80% %

3 Two point mutations at a time BRCA1 exon 18 Binding of DAZAP1 and hnRNPA1/A2 to an Exonic Splicing Silencer in a Natural BRCA1 Exon 18 Mutant Goina E, Skoko N, Pagani F. Mol Cell Biol 2008; 28: 3850–3860 Complete exon 18 skipping Decreased efficiency

4 WT 5 -ACAGTTGTTGGCGGTTG-3 TACCACCC TTATT GGTTC AA CCGC G G T GTGAGTCTCGCACACACCTTCAGTTCT WT 144A 145C146A147G148T149T150G151T153G154G155C156G157G ex9 + ex9 - % exon 9 inclusion Effect of variations in CFTR exon 9 Pagani, F., Buratti, E., Stuani, C., and Baralle, F. E. (2003) J Biol Chem Pagani, F., Stuani, C., Zuccato, E., Kornblihtt, A. R., and Baralle, F. E. (2003) J Biol Chem A pathological

5 The genetic code is degenerate, but it is not all rodustness... Ala Val Arg... GCA C G T GTA C G T CGA C G T AGA G GCAGTACGA GCAGTACGC GCAGTACGG GCAGTACGT GCAGTAAGA GCAGTAAGG GCAGTCCGA GCAGTCCGC GCAGTCCGG GCAGTCCGT GCAGTCAGA GCAGTCAGG GCAGTGCGA GCAGTGCGC GCAGTGCGG GCAGTGCGT GCAGTGAGA GCAGTGAGG GCAGTTCGA GCAGTTCGC GCAGTTCGG GCAGTTCGT GCAGTTAGA GCAGTTAGG GCCGTACGA GCCGTACGC GCCGTACGG GCCGTACGT GCCGTAAGA GCCGTAAGG GCCGTCCGA GCCGTCCGC GCCGTCCGG GCCGTCCGT GCCGTCAGA GCCGTCAGG GCCGTGCGA GCCGTGCGC GCCGTGCGG GCCGTGCGT GCCGTGAGA GCCGTGAGG GCCGTTCGA GCCGTTCGC GCCGTTCGG GCCGTTCGT GCCGTTAGA GCCGTTAGG GCGGTACGA GCGGTACGC GCGGTACGG GCGGTACGT GCGGTAAGA GCGGTAAGG GCGGTCCGA GCGGTCCGC GCGGTCCGG GCGGTCCGT GCGGTCAGA GCGGTCAGG GCGGTGCGA GCGGTGCGC GCGGTGCGG GCGGTGCGT GCGGTGAGA GCGGTGAGG GCGGTTCGA GCGGTTCGC GCGGTTCGG GCGGTTCGT GCGGTTAGA GCGGTTAGG GCTGTACGA GCTGTACGC GCTGTACGG GCTGTACGT GCTGTAAGA GCTGTAAGG GCTGTCCGA GCTGTCCGC GCTGTCCGG GCTGTCCGT GCTGTCAGA GCTGTCAGG GCTGTGCGA GCTGTGCGC GCTGTGCGG GCTGTGCGT GCTGTGAGA GCTGTGAGG GCTGTTCGA GCTGTTCGC GCTGTTCGG GCTGTTCGT GCTGTTAGA GCTGTTAGG 4 * 4 * 6 = 96 Three AAs specified by 96 synonymous words

6 An additional exonic constraints: the splicing code

7 exon31 cryptic exon NF1 gene A>G ttttatagTGAGAATA WTMUT Raponi M, Upadhyaya M, Baralle D. Functional splicing assay shows a pathogenic intronic mutation in neurofibromatosis type 1 (NF1) due to intronic sequence exonization. Hum Mutat. 2006; 27(3): La mutazione attiva un esone criptico (in rosso)

8 TAGgtaata TAGgtggga TAGataata CAGgtattg CAAgtattg CAAgtaagc CAAgtaagg Raponi M, Upadhyaya M, Baralle D. Functional splicing assay shows a pathogenic intronic mutation in neurofibromatosis type 1 (NF1) due to intronic sequence exonization. Hum Mutat. 2006;27(3): exon31 cryptic exon NF1 gene Disruption of 5ss restores normal splicing La seq 2 ha un sito di splicing in 5 più debole della seq 1. La seq 3 non ha il sito.

9 ATM gene structure M WT del mut mutations results A new type of mutation causes a splicing defect in ATM Pagani F, Buratti E, Stuani C, Bendix R, Dörk T, Baralle FE Nature Genetics 2002, 30: WT: GGCCAGGTAAGTGATA DEL: GGCCAG____GTGATA MUT: GGCCAGGTCTGTGATA

10 AIM: SPLICING PREDICTION TOOL pre mRNA sequence mRNA structure

11 A compact formalism, but… score matrix

12 Experimental assessed binding sites A C G T G consensus sequence AGG AGT CGG CGT unzip AGG AGT CGT AGG CGT Compression and reconstruction of motifs zip

13

14 elements promoting exons elements promoting introns

15

16 ESE, ISS: esone ESS, ISE: introne

17 9G8, CUG-BP1, DAZAP1, ETR-3, Fox-1, Fox-2, FMRP, hnRNP A0, hnRNP A1, hnRNP A2/B1, hnRNP C, hnRNP C1, hnRNP C2, hnRNP D, hnRNP D0, hnRNP DL, hnRNP E1, hnRNP E2, hnRNP F, hnRNP G, hnRNP H1, hnRNP H2, hnRNP I (PTB), hnRNP J, hnRNP K, hnRNP L, hnRNP LL, hnRNP M, hnRNP P (TLS), hnRNP Q, hnRNP U, HTra2alpha, HTra2beta1, HuB, HuD, HuR, KSRP, MBNL1, Nova-1, Nova-2, nPTB, PSF, RBM4, RBM25, Sam68, SAP155, SC35, SF1, SF2/ASF, SLM-1, SLM-2, SRp20, SRp30c, SRp38, SRp40, SRp54, SRp55, SRp75, TDP43, TIA-1, TIAL1, YB-1, ZRANB2 … PROTEINS REGULATING SPLICING STORED IN SPLICEAID

18

19 SEQUENCE SPLICEAIDPREDICTORS EXPERIMENTALLY ASSESSED BINDING ESE FinderRescue ESE Splicing Rainbow ACAACYB-1no bindingno ESESRp40 GAAGAAGA HTra2A, HTra2B1, SF2/ASF, SC35, SRp40, SRp55, SRp75 no binding3 ESETra2B CUGGCGUCGUCGCno binding SF2/ASF, SRp55 2 ESESRp40, SRp55 UGACUGhnRNP A1no bindingno ESESRp40, SRp55 UUUUAGACAA hnRNP C1, Sam68, hnRNP A1, hnRNP D, hnRNP E1, hnRNP E2, SRp38 no binding1 ESE hnRNP A2/B1, hnRNP C1/C2, hnRNP E1/E2, SRp40, SRp55, U2AF65 UGUGUGUGUGUGUGUGUG CUG-BP1, ETR-3, TDP43 SRp55no ESEhnRNP U Some comparisons among literature data (SpliceAid) and prediction tools

20 SpliceAid 2

21

22 110mn Giunzioni esoniche in fase 0 A……………………………………………………..A T……………………………………………………...T T…………………………T G……………………………G G………………………..G G…………………………………………..C G………………………………………………..G A…………………………………A A………………………………………….A A………………………….A A………………………………......A C………G C……………….C T…...G A………A C………G T………T A………………A C………………C A……………………….A A……………………….T C……………………….C C………………………….C m n Giunzioni esoniche in fase 1 G………………………………………………..…..G A………………………………....A A T T……………………………………………..T A……………….A A…………………………A A…………………………………..A C......C C……….C G………C A..T C..C T…C T…T C……G T……T T………G C………….G C………………………..T C……………………………G mn1 Giunzioni esoniche in fase 2 A………………………………....A A…………………………………………..A A……………………………………………A A………T A……………………….A T……T C…………...G Correlazioni favorite tra la fine di un esone e linizio del successivo

23 G…………………………………..G G……………………………………..G G………………………………………………………...C G…………………………………………………………...C G…………………………………………………….……..T A……………………………A T…………………………….A T…………………………….T A…………………………………….A T……………………………………..T A……………………………… A T A T T T T A………………….A T…………………..A A……………………..……A A A A T T T C G C G A A T A T T A A T T A A T T C C T T G… G G… G T……………………………………..A T…………………………………..…...G T………………………………………….……….A T……………………………………… C C C A A T A A A A T T…………………………………..………….A T T C C T T T A A A T A A A C G G G A T T T A……………….……….A C……………………………………C T…………………………………………………………………….C A A T A A A T A C C A A A…………………………………………… T A C A A T A A A T T A A T T G T T A A A A T A T T A A C G C Fase 0 1 Fase 0 2 Esoni che iniziano in fase 0 e terminano in fase 0 Correlazioni tra linizio e la fine degli introni umani

24 Elaborazioni in corso al CASPUR tramite ClustalW multiprocessore e programmazione multithreading… per ripetere le analisi su un insieme di geni con minore ridondanza Seq ridondanti Seq 1 Seq 2 Seq 3 Seq 4 Seq 5 … Seq N Seq NON ridondanti Seq ridondanti - Seq 2 Seq 3 Seq 4 Seq 5 … Seq N Seq NON Ridondanti Seq 1 Seq ridondanti - Seq 3 Seq 4 Seq 5 … Seq N Seq NON Ridondanti Seq 1 Seq 2 Seq ridondanti - Seq 4 Seq 5 … Seq N Seq NON Ridondanti Seq 1 Seq 2 Seq 3 Seq ridondanti - Seq 5 … Seq N Seq NON Ridondanti Seq 1 Seq 2 Seq 3 Seq 4 Partendo da un insieme di sequenze, se non effettuo nessun pruning, dovrei compiere al massimo allineamenti

25 Altri lavori pubblicati o accettati nel 2010: Piva F, Giulietti M, Nardi B, Bellantuono C, Principato G. An improved in silico selection of phenotype affecting polymorphisms in SLC6A4, HTR1A and HTR2A genes. Human Psychopharmacology 2010; 25: Piva F, Ciaprini F, Onorati F, Benedetti M, Fattorini D, Ausili A, Regoli F Assessing sediment hazard through a Weight Of Evidence approach with bioindicator organisms: a practical model to elaborate data from sediment chemistry, bioavailability, biomarkers and ecotoxicological bioassays Chemosphere 2010 accepted Bianchi F, Raponi M, Piva F, Viel A, Bearzi I, Galizia E, Bracci R, Belvederesi L, Loretelli C, Brugiati C, Corradini F, Baralle D, Cellerino R. An intronic mutation in MLH1 associated with familial colon and breast cancer. Familial Cancer 2010 published Nardi B, Turchi C, Piva F, Giulietti M, Castellucci G, Arimatea E, Rocchetti D, Rocchetti G, Principato G, Tagliabracci A, Bellantuono C Searching for a relationship between the Serotonin Receptor 2A Gene variations and the development of Inward and Outward Personal Meaning Organisations Psychiatric Genetics 2010 accepted Lavori inviati nel 2010: Piva F, Giulietti M, Ballone Burini A, Principato G SpliceAid 2: a database of human splicing factors expression data and RNA target motifs Piva F, Giulietti M, Baldelli L, Nardi B, Bellantuono C, Armeni T, Saccucci F, Principato G Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene Piva F, Giulietti M, Principato G CLIP data to detect polymorphisms lying in splicing regulatory motifs: a method to refine SNP selection in association studies Turchi C, Piva F, Solito G, Principato G, Buscemi L, Tagliabracci A ADH4 intronic variations are associated with alcohol dependence: results from an Italian case-control association study Lenzi L, Facchin F, Piva F, Giulietti M, Pelleri MC, Frabetti F, Vitale L, Casadei R, Canaider S, Bortoluzzi S, Coppe A, Danieli GA, Principato G, Ferrari S, Strippoli P TRAM (Transcriptome Mapper): database-driven creation and analysis of transcriptome maps from multiple sources Facchin F, …, Piva F,.... Complexity of bidirectional transcription and alternative splicing at human RCAN3 locus

26 Giovanni Principato Francesco Piva Matteo Giulietti


Scaricare ppt "17 dicembre 2010 Trento Linguaggi sovrapposti: il codice dello splicing Piva F, Giulietti M, Principato G Department of Biochemistry, Biology and Genetic."

Presentazioni simili


Annunci Google