La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

SISTEMA T7/Lac Sequenza della regione di clonaggio del pET21a Single-stranded sequencing should be performed using the T7 terminator and promoter primers.

Presentazioni simili


Presentazione sul tema: "SISTEMA T7/Lac Sequenza della regione di clonaggio del pET21a Single-stranded sequencing should be performed using the T7 terminator and promoter primers."— Transcript della presentazione:

1 SISTEMA T7/Lac Sequenza della regione di clonaggio del pET21a Single-stranded sequencing should be performed using the T7 terminator and promoter primers The T7 tag is an epitope tag composed of an 11-residue peptide Epitope tags are useful for the labeling and detection of proteins using immunoblotting, immunoprecipitation, and immunostaining techniques His tag for affinity cromatography

2

3 mRNA

4 Rho–independent mechanism The Rho-Independent termination signals The intrinsic terminator sequence is an inverted repeat of GC-rich sequence followed by 4 or more adenines. The transcribed RNA forms stem-loop structure at inverted repeats via internal base pairing The formation of this stem-loop structure disrupts hydrogen bonding between RNA uracils and DNA adenines at site of transcription (weak because only 2 H-bonds between A and U as compared to 3 between G and C) As a result, RNA is released from the DNA template

5 What is an inverted repeat? A sequence of several bases in double-stranded DNA that is repeated in an inverted fashion Example: 5'.....GCCGCCAG CTGGCGGC....3' 3'.....CGGCGGTC GACCGCCG....5' (template strand) transcribed RNA: 5' GCCGCCAG CTGGCGGC.....3' Consequently there are internal sequences in the transcribed RNA that are complementary and can therefore base pair to form a stem-loop structure

6 Specific-sequence mechanism Rho-dependent Termination Signals Some termination sequences lack the series of adenines which are transcribed in to URACILS on the RNA. The RNA in such situations needs assistance from a specific protein (termed Rho) which is necessary for termination. Rho binds at the 5'end of the RNA and scans down the RNA until it catches up with an RNA polymerase which is paused at a stem-loop structure. In Rho dependent termination, the Rho protein forces the RNA to separate from the DNA template.

7

8 SISTEMA pBAD AraBAD = operone che codifica tre geni A, B, D e convertono arabinosio in xilulosio-5-P AraC proteina regola 1) l’operone araBAD attivandolo o disattivandolo, 2) la propria sintesi legandosi quando c’è alta la sua concentrazione al sito operatore O1 e reprimendo in al modo la sua trascrizione Geni coinvolti nel metabolismo del’arabinosio Sistema che attiva la trascrizione di pBAD Sistema che reprime la trascrizione di pAraC AraC

9

10 SISTEMA pBAD Sequenza della regione di clonaggio del pBAD/gIII C

11 Cold shock promoters The cold shock response is one of the multiple adaptive mechanisms evolved by bacteria to survive stressful situations. In E. coli, rapid transfer of exponentially growing cells from 37 to 15°C leads to the upregulation of cold shock proteins whose task is to restore efficient transcriptional and translational processes in stressed cells. CspA, a protein that is virtually undetectable at 37°C, undergoes the most dramatic increase in accumulation upon temperature downshift, and over 10% of the total protein synthesis is dedicated to its production during the first hour following transfer to 15°C. Thereafter, CspA production is repressed. CspA functions as an RNA chaperone to prevent the formation of stable secondary structures in RNA molecules at low temperature and thus facilitates translation of cellular mRNAs at low temperatures. A common feature shared by CspA and other cold-inducible proteins is the presence of a 5' untranslated region (UTR) ranging in length from 155 to 161 nucleotides. This extension destabilizes transcripts to which it is fused at physiological temperatures, while it stabilizes adjoining mRNA and favors their translation following temperature downshift. Because recombinant protein folding is favored at low temperatures while degradation is less efficient under the same conditions, we are exploiting the useful characteristics of the cspA promoter to produce aggregation-prone and/or unstable recombinant proteins at low temperatures. Schematic representation of the cspA promoter region. The 5'UTR includes a cold box that is conserved among cold-inducible proteins and important in regulation. RBS denotes the ribosome binding site, while UP denotes an upstream element responsible for enhanced transcription at low temperatures. DB indicates the location of a downstream box in the cspA coding region. UP denotes an upstream element responsible for enhanced transcription at low temperatures

12 The cold shock expression system is repressed at 37 °C and induced by transfer of the bacteria to low temperature. Cellular protein production stops after transfer to the 15 °C labeling medium. NMR spectra obtained from centrifuged (100,000g) lysates after sonication are very similar to those of the purified protein. The pCold protein production system in E. coli.

13 pCOLD system  In cold conditions E. coli growth is halted and a pool of proteins are expressed  Cold shock promoter based (cspA) – Your gene is downstream  TEE means translation-enhancing element and is a five-codon sequence which has been shown to enhance translation initiation Nature Biotechnology 22, (2004)

14 Stabilità dell’ mRNA

15 Introdurre modifiche sull’organismo E. coli Introdurre modifiche sul vettore di espressione o sul gene stesso Ottimizzazione della fase traduzionale per esprimere la mia proteina ricombinante

16 Problemi di basse rese di proteina ricombinante solubile Problema di folding Problema di overespressione o crescita cellulare

17

18

19 PROTEINE di fusione

20 In alcuni vettori di espressione il sito di clonaggio non è immediatamente adiacente alla sequenza di ribosome binding, ma è preceduta da un segmento iniziale di DNA di un gene appartenente a un gene di E. coli Il prodotto di espressione genica è quindi una proteina ibrida che consiste di un corto peptide codificato dal E.coli reading frame fuso con l’amino terminale della proteina clonata. The gene fusion

21 Espressione di proteine native AGGAAAC AGAAC GATCCGTCGGATAATTAGCTGA TCC TTTG TCTT GGTAC GCAGCCTATTAATCGACT NcoIBamHI RBS AGGAAAC AGAACCATGGGAGGATCCGTCGGATAATTAGCTGA TCC TTTG TCTT GGTACCCT CCTAGGCAGCCTATTAATCGACT AGGAAAC AGAACCATGG GGATCCGTCGGATAATTAGCTGA TCC TTTG TCTT GGTACC CCTAGGCAGCCTATTAATCGA CT C-DNA ATG TAA Met La maggior parte dei vettori d’espressione per proteine native hanno un sito di restrizione unico per NcoI posizionato a valle del promotore. Un vettore d’espressione può essere usato per produrre una proteina nativa o una proteina chimerica. Quando si vuole studiare l’attività biologica di una proteina si preferisce utilizzare un vettore d’espressione nativo.

22 Espressione di proteine di fusione Sempre più spesso si preferisce esprimere proteine di fusione, per la loro maggiore stabilità, gli alti livelli di espressione e la relativa facilità con cui si purificano, con queste proteine chimeriche si pone: AGGAAAC AGAACCATG GGATCCGTCGAAGCTTGATAATTAGCTGA TCC TTTG TCTT GGTAC CCTAGGCAGCTTCGAACTATTAATCGA CT GST BamHIHindIII AGGAAAC AGAACCATG G AGCTTGATAATTAGCTGA TCC TTTG TCTT GGTAC CCTAG ACTATTAATCGACT GST AGGAAAC AGAACCATG TCC TTTG TCTT GGTAC GST GGATCC CCTAGG cDNA IgG AAGCTT TTCGAA Met GST IgG

23 Met GST IgG AGGAAAC AGAACCATG TCC TTTG TCTT GGTAC GST GGATCC CCTAGG cDNA IgG AAGCTT TTCGAA GlySerGluAlaCysTyrValAla Met GST ? AGGAAAC AGAACCATG TCC TTTG TCTT GGTAC GST GGATCCAAA CCTAGGTTT cDNA IgG AAGCTT TTCGAA GlySerGluAlaMetAspLysPhe

24 I vantaggi della gene fusion Una efficiente traslazione dell’mRNA dipende non solo dalla presenza del ribosome binding site ma è anche influenzata dalla sequenza di nucleotidi all’inizio della regione codificante. Questo effetto è impedito se questa regione è fatta interamente da naturale E. coli sequenza. La presenza di un peptide batterico all’inizio della proteina fusa stabilizza la molecola proteica contro la degradazione. Il segmento peptidico può costituire un “signal peptide”, responsabile per dirigere le naturali proteine del E.coli nella posizione corretta all’interno della cellula. L’esportazione della proteina è particolarmente utile perché semplifica il problema di purificazione della proteina ricombinante dalla cultura Il segmento batterico può anche aiutare nella purificazione proteica E’ importante che la sequenza nucleotidica tra la SD e il codone d’inizio non sia disturbata da strutture secondarie ( es. hairpin loops ) che possono interferire drasticamente con il legame al ribosoma e la conseguente traduzione.

25 Affinity cromatography La fusione “dell’ospite” con la proteina glutatione-S-transferasi (GST) del E.coli permette di purificare la proteina ospite attraverso colonne contententi agarose beads che portano legato glutatione:

26 Affinity cromatography Necessità di rimuovere la proteina fusa altrimenti le proprietà della proteina ricombinante possono essere alterate In genere, enzimi come trombina che taglia accanto a residui Arg oppure Factor Xa che taglia dopo Gly-Arg si usano per rimuovere proteine fuse al proteina ricombinante a meno che la sequenza di riconoscimento non sia presente all’interno della proteina ricombinante

27 Problemi generali con la produzione di proteine ricombinanti in E. coli 1.Problemi causati dalla sequenza del gene ricombinante a. Il gene contiene introni e E. coli non possiede la necessaria organizzazione per rimuovere gli introni dai geni trascritti

28 Problemi generali con la produzione di proteine ricombinanti in E. coli 1.Problemi causati dalla sequenza del gene ricombinante b. Il gene contiene sequenze di basi che sono riconosciute nel E. coli come segnali di terminazione della proteina e quindi si ottiene una terminazione prematura e perdita del gene di espressione

29 Problemi generali con la produzione di proteine ricombinanti in E. coli 1.Problemi causati dalla sequenza del gene ricombinante c. L’utilizzo dei codoni del gene può non essere ideale per la traslazione in E. coli. Tutti gli organismi usano lo stesso codice genetico, ma ciascun organismo ha un bias verso preferenziali codoni. Se un gene clonato contiene un alta proporzione di codoni sfavorevoli, allora il tRNA può incontrare difficoltà nella traslazione del gene, riducendo la quantità di proteina sintetizzata

30 OTTIMIZZAZIONE DELLA STABILITA’ Utilizzo di codoni alternativi Poiché organismi diversi possono utilizzare preferenzialmente codoni sinonimi per specificare uno stesso amminoacido e poiché è nota la percentuale di utilizzazione media dei codoni sinonimi in molti organismi è possibile aumentare i livelli di espressione modificando i codoni del gene di interesse senza alterarne il prodotto di espressione.

31 Problemi generali con la produzione di proteine ricombinanti in E. coli 2. Problemi causati dalle limitazioni del E. coli come ospite per la sintesi di proteine ricombinanti a.E. coli può non “produrre” correttamente la proteina ricombinante, cioè proteine di molti organismi dopo la traslazione subiscono modificazioni chimiche di amminoacidi che sono essenziali per una corretta attività biologica, oppure subiscono glicosilazione. E. coli non glicosila le proteine. Questi problemi non si risolvono si ricorre ad sistemi di espressioni eucariotici quali lieviti, funghi, baculovirus.

32 Problemi generali con la produzione di proteine ricombinanti in E. coli 2. Problemi causati dalle limitazioni del E.coli come ospite per la sintesi di proteine ricombinanti b. E. coli può non foldare correttamente la proteina, la quale in genere risulta insolubile e forma i cosiddetti inclusion body all’interno del batterio. Questi problemi possono essere risolti facendo uno screening su diversi tipi di E. coli strain o re- folding.

33 Corpi di inclusione: Cause probabili Precipitazioni non specifiche dovute ad un contenuto elevato di proteina Presenza insufficiente di chaperones/folding enzymes con conseguente aggregazione di intermedi parzialmente foldati Mancanza di modificazioni post-trasduzionali (proteine eucariote) portano a prodotti meno stabili Proteina tossica per il batterio Aggregati insolubili che accumulano prodotti di scarto del batterio Opachi al microscopio Diametro 1 µ m Composti per lo pi ù di proteina eterologa

34 Problemi generali con la produzione di proteine ricombinanti in E. coli 2. Problemi causati dalle limitazioni del E.coli come ospite per la sintesi di proteine ricombinanti c. E. coli può degradare la proteina ricombinante perché non la riconosce come propria. Come il riconoscimento avviene non è tuttora noto. I problemi del punto 2c possono essere risolti utilizzando E. coli strain mutanti cioè mancanti di una o più protesi responsabili per la degradazione proteica.

35 L’utilizzo di ceppi carenti in proteasi Un altro modo per ottimizzare la stabilità dei prodotti di espressione, consiste nel minimizzare la degradazione proteolitica a carico delle proteine espresse A causa della presenza in E. coli di più venti proteasi, solo alcune delle quali risultano essere caratterizzate, questo obbiettivo è difficile da ottenere. Sono tuttavia disponibili ceppi di coli mutanti che risultano difettiva in una o più di queste proteasi, come ad esempio omp

36 Strain Company Main feature BL21(DE3) Novagen protease deficient BL21(DE3) pLysS Novagen produce lysozyme BL21(DE3) pLysE Novagen produce more lysozyme than S OrigamiB(DE3)pLysS Novagen trx, glutathione reductase mut (disulfide bridges) Rosetta(DE3)pLysS Novagen supply tRNA for 6 rare codons BL21(DE3)codon plus Stratagene supply tRNA for rare codons C41(DE3) Avidis SA more tolerant than 21 to toxic proteins C43(DE3) Avidis SA idem for one specific protein B834(DE3) Novagen met auxotroph  Se-met labelling Electron micrographs of thin sections of E. coli C43(DE3) cells over-producing subunit b of E. coli ATP synthase, 3 and 18 h after induction at 37 or 25°C, respectively. Ceppi di E. coli


Scaricare ppt "SISTEMA T7/Lac Sequenza della regione di clonaggio del pET21a Single-stranded sequencing should be performed using the T7 terminator and promoter primers."

Presentazioni simili


Annunci Google