La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Bioinformatica Corso di Laurea specialistica in Informatica RNA: trascrizione e maturazione 21/03/2011.

Presentazioni simili


Presentazione sul tema: "Bioinformatica Corso di Laurea specialistica in Informatica RNA: trascrizione e maturazione 21/03/2011."— Transcript della presentazione:

1 Bioinformatica Corso di Laurea specialistica in Informatica RNA: trascrizione e maturazione 21/03/2011

2 Il dogma della Biologia

3 La trascrizione La trascrizione produce una catena di RNA identica nella sequenza ad un tratto di filamento di DNA codificante e complementare al filamento stampo su cui avviene la sua sintesi.

4 La trascrizione (2) Gene sul filamento senso (5-3) 5- AGAACGATGCCAAATCGTTAATAGCATA – 3 3- TCTTGCTACGGTTTAGCAATTATCGTAT – |||||||||||||||||||||||| AGAACGAUGCCAAAUCGUUAAUAGCAUA – 3 mRNA (RNA Messaggero) Per trascrivere il filamento senso viene usato come stampo il filamento antisenso. Analogamente, per trascrivere il filamento antisenso viene usato come stampo il filamento senso. Gene sul filamento senso (5-3) 5- AGAACGATGCCAAATCGTTAATAGCATA – 3 3- TCTTGCTACGGTTTAGCAATTATCGTAT – |||||||||||||||||||||||| AGAACGAUGCCAAAUCGUUAAUAGCAUA – 3 mRNA (RNA Messaggero) Per trascrivere il filamento senso viene usato come stampo il filamento antisenso. Analogamente, per trascrivere il filamento antisenso viene usato come stampo il filamento senso.

5 La trascrizione nei procarioti La sintesi dell'RNA avviene all'interno di una bolla di trascrizione in cui il DNA viene temporaneamente separato in due filamenti singoli e il filamento stampo è usato per la sintesi del filamento di RNA. La sintesi parte dall'estremità 5' e procede in direzione dell'estremità 3'. La trascrizione ha inizio quando l'enzima RNA polimerasi si lega ad un promotore del gene da trascrivere, originando la bolla di trascrizione.

6 L'RNA polimerasi Una bolla si sposta insieme alla RNA polimerasi, man mano che l'enzima si muove lungo il DNA e la catena dell'RNA si allunga. L'RNA polimerasi controlla e catalizza l'appaiamento e l'aggiunta delle basi all'interno della bolla. La trascrizione consiste di 3 fasi: –Inizio –Allungamento –Terminazione

7 Le tre fasi della trascrizione: l'inizio Il riconoscimento dello stampo ha inizio col legame della RNA polimerasi sulla doppia elica del DNA a livello del promotore. I filamenti del DNA si separano e il filamento stampo si rende disponibile all'appaiamento con i ribo-nucleotidi. Col termine inizio si indica la sintesi dei primi legami nucleotidici dell'RNA. In questa fase l'RNA polimerasi può produrre brevi trascritti e rilasciarli, per poi riprendere a sintetizzare l'RNA da capo. La fase di inizio termina quando l'enzima riesce a produrre una catena sufficientemente lunga e lascia il promotore.

8 L'allungamento Durante l'allungamento l'enzima si sposta lungo il DNA ed estende la catena di RNA in crescita. Mentre si sposta, l'enzima svolge la doppia elica del DNA per esporre sotto forma di filamento singolo un nuovo segmento dello stampo. Il filamento stampo nella regione già attraversata si appaia di nuovo col filamento originale ristabilendo la doppia elica. L'RNA emerge come filamento singolo.

9 La terminazione La terminazione comporta il riconoscimento del punto in cui deve cessare l'aggiunta di ulteriori basi alla catena. Affinché la trascrizione termini, il complesso di trascrizione deve dissociarsi. Dopo l'aggiunta dell'ultima base all'RNA, la bolla di trascrizione collassa, il DNA riprende lo stato duplex e sia l'enzima che l'RNA vengono rilasciati. Il segnale di terminazione è definito nella sequenza di DNA.

10 Com'è fatta la RNA polimerasi? Le RNA polimerasi meglio caratterizzate sono quelle dei batteri, in particolare Escherìchia coli. L'enzima completo, o oloenzima, di E. coli è costituito da 5 subunità. Nell'oloenzima si distinguono 2 componenti: –Il nucleo –Il fattore sigma Le RNA polimerasi eucariotiche consistono invece di molte subunità.

11 Il nucleo e il fattore sigma Soltanto l'oloenzima può iniziare la trascrizione. Il fattore sigma garantisce che la RNA polimerasi si leghi in maniera stabile al DNA soltanto a livello dei promotori. Il fattore sigma non è necessario per l'allungamento e dopo l'inizio può essere rilasciato. Il nucleo della polimerasi ha la capacità di sintetizzare RNA su uno stampo di DNA, ma non può dare inizio alla trascrizione a livello dei siti appropriati. Il nucleo lega il DNA mediante un legame debole: nel DNA non si verifica alcun cambiamento e la molecola resta duplex. Il nucleo non è in grado di distinguere fra i promotori e le altre sequenze di DNA. Il fattore sigma controlla la specificità: l'oloenzima si lega con molta forza ai promotori.

12 La RNA polimerasi riconosce il promotore Tutte le molecole di RNA polimerasi si trovano già legate al DNA. I nuclei dell'enzima si trovano legati al DNA (chiuso) in complessi deboli. In che modo l'RNA polimerasi riconosce i promotori? Una RNA polimerasi libera si lega al DNA e resta in contatto con esso, passando da una sequenza all'altra fino a quando raggiunge un promotore. A questo punto può avere inizio la trascrizione.

13 Com'è fatto un promotore? La funzione di un promotore non è di essere trascritta e tradotta, ma di farsi riconoscere dalle proteine. L'informazione per la funzione del promotore sta direttamente nella sua sequenza, che costituisce il segnale. La sequenza di un promotore non deve necessariamente essere contigua e lo spazio tra due elementi distaccati può essere parte stessa del segnale.

14 Sequenze consenso Per studiare i promotori è necessario confrontarli tra loro. Le sequenze essenziali sono presenti in tutti i promotori e sono sequenze conservate. E' comunque ammesso un certo grado di variazione. I possibili segnali sul DNA vengono definiti sulla base di sequenze idealizzate, dette sequenze consenso, nelle quali ogni posizione è rappresentata dalla base che vi compare con maggiore frequenza. Un promotore è dunque definito dalla presenza di brevi sequenze consenso in posizioni specifiche. I singoli promotori in genere differiscono dal consenso in una o più posizione.

15 Sequenze consenso (2) Relativamente al sito di inizio della trascrizione, le sequenze consenso a -35 e a -10 contengono gran parte dei punti di contatto tra RNA polimerasi e promotore. A -10 si trova la sequenza consenso TATAAT A -35 si trova la sequenza consenso TTGACA Il promotore ottimale è una sequenza che consiste dell'esamero -35, separato da 17 bp dall'esamero -10, che si trova a 7 bp a monte del punto di inizio della trascrizione.

16 Terminatori Un terminatore è una sequenza di DNA che provoca la terminazione della trascrizione da parte della RNA polimerasi. Una volta che ha iniziato la trascrizione, l'RNA polimerasi si muove lungo lo stampo, sintetizzando RNA, finché non incontra la sequenza di un terminatore. A questo punto l'enzima cessa di aggiungere nucleotidi alla catena, rilascia il prodotto completo e si dissocia dallo stampo di DNA.

17 Due tipi di terminatori In E. coli esistono due diversi tipi di terminatori: –Terminatori intrinseci Un nucleo dell'enzima può terminare la trascrizione a livello di questi siti in assenza di altri fattori. –Terminatori rho-dipendenti Necessitano di un ulteriore fattore, il fattore rho, perché la trascrizione termini. Il fattore rho è una proteina che assiste l'RNA polimerasi di E. coli nella terminazione della trascrizione a livello dei terminatori rho- dipendenti.

18 Terminazione della trascrizione Le sequenze dei terminatori sono localizzate prima del punto in cui viene aggiunta l'ultima base all'RNA. La terminazione si basa sull'esame dello stampo o del prodotto che la polimerasi sta trascrivendo. I terminatori intrinseci consistono di una forcina ricca di GC nel prodotto di RNA, seguita da una regione ricca di U in cui avviene la terminazione.

19 La trascrizione negli eucarioti Negli eucarioti la trascrizione è più complessa. Vi sono 3 tipi di RNA polimerasi: –RNA-POL. I Trascrive i geni di prima classe –RNA-POL. II Trascrive i geni di seconda classe –RNA-POL. III Trascrive i geni di terza classe

20 Le fasi della trascrizione negli eucarioti Anche negli eucarioti si possono distinguere grossolanamente tre fasi: –Inizio –Allungamento –Terminazione

21 L'inizio della trascrizione negli eucarioti LRNA polimerasi non è capace di riconoscere da sola il proprio promotore. E necessaria la presenza di proteine specifiche, chiamate fattori generali di trascrizione che permettono linizio della trascrizione. Nei geni che codificano le proteine alcuni fattori trascrizionali si legano a sequenze specifiche del promotore, mentre altri sembra che si leghino direttamente allRNA polimerasi quando questa inizia la trascrizione.

22 I promotori negli eucarioti Il promotore di un gene eucariotico è organizzato in una serie di elementi promotori, o moduli promotori. Partendo da quello più vicino al sito dinizio di trascrizione, gli elementi promotori sono il TATA box,il CAAT box e il GC box. Gli elementi sono chiamati così per le sequenze consenso di basi di DNA che contengono. Gli elementi promotori sono fondamentali per la regolazione dellespressione genica.

23 I promotori negli eucarioti (2) Un gene che codifica per una proteina può possedere un grande assortimento di sequenze di DNA coinvolte nella regolazione della trascrizione. Queste sequenze vengono definite elementi di regolazione e possono essere localizzate sia a monte sia a valle del punto dinizio della trascrizione dellRNA. Questi elementi regolatori possono legare dei fattori trascrizionali specifici,cioè proteine coinvolte nellattivazione o nella repressione della trascrizione di uno specifico gene. Gli elementi regolatori in posizione più distale sono chiamati enhancers e sono necessari per ottenere il massimo grado di trascrizione per un dato gene. Esistono degli elementi, chiamati silencers, che hanno caratteristiche simili agli enhancer, ma che reprimono la trascrizione anziché attivarla.

24 Il complesso di trascrizione TBP (TATA- box Binding Protein) è una proteina fondamentale per l'inizio della trascrizione. Essa lega il TATA-box e consente la formazione del complesso di trascrizione.

25 L'allungamento e la terminazione La fase di allungamento è del tutto simile a quella dei procarioti ed avviene in direzione 5'->3'. Non sono state individuate sequenze specifiche che indichino la fine della trascrizione negli eucarioti. Per la RNA-POL. II si è osservato che la terminazione avviene circa 1000 nt a valle della sequenza consenso 5'-AAUAAA-3'.

26 La maturazione dell'RNA

27 Lo splicing Nei geni eucariotici la regione codificante (esoni) è interrotta da sequenze non codificanti (introni): Lo splicing dell'RNA è il processo con cui sono escissi dall'RNA gli introni, mentre gli esoni vengono uniti tra loro a formare una molecola continua di mRNA.

28 Il 5' CAP Lo splicing dell'RNA avviene nel nucleo, insieme ad altre modificazioni a cui sono sottoposti gli RNA appena sintetizzati. Il trascritto, prima dello splicing, viene dotato di un cappuccio sull'estremità 5', costituito da una guanina legata dalla parte 5' (Legame "insolito" 5'-5'). Le funzioni del CAP: –Regolazione dell'esportazione del mRNA nel citoplasma –Stabilità dell'mRNA –Riconoscimento del mRNA da parte dei ribosomi nel citoplasma (traduzione) –Facilita lo splicing dell'introne prossimale al 5'

29 La coda di Poli (A) Il terminale 3' dell'mRNA è modificato dall'aggiunta di residui A alla sequenza codificata dal gene. Questa sequenza aggiuntiva prende il nome di coda di poli(A) e l'aggiunta di tale sequenza è detta poliadenilazione. L'aggiunta della coda di poli(A) è catalizzata dall'enzima poli(A) polimerasi, che aggiunge circa 200 residui di A all'estremità 3' libera dell'mRNA. Alla coda di poli(A) si lega una proteina chiamata PABP (Poly(A)-binding protein). La presenza della coda di poli(A) stabilizza l'mRNA e lo protegge dalla degradazione.

30 Lo splicing Lo splicing dell'mRNA consiste nella rimozione degli introni. I siti di splicing sono le sequenze immediatamente circostanti i confini esone- introne. Di solito gli introni iniziano per GT e terminano per AG. Questa coppia di dinucleotidi è un segnale per l'individuazione degli introni. Il sito GT è detto donatore di splicing, AG è detto accettore di splicing.

31 Segnali sul gene eucariotico

32 Lo splicing Viene effettuato un taglio alla giunzione in 5. Lestremità 5 libera dellintrone si piega su se stessa formando un occhiello e si unisce ad una A, che fa parte di una sequenza chiamata sequenza del punto di ramificazione. Quindi avviene un taglio al sito di giunzione 3 di splicing e la ligazione delle due sequenze codificanti. Il processamento avviene in un complesso specifico detto Spliceosoma, costitutito da molecole ribonucleoproteiche (snRNA + Prot = snRNP).

33 Lo splicing alternativo Lo splicing alternativo è il processo con cui a partire da un singolo trascritto vengono ottenuti RNA differenti, tramite cambiamenti nell'utilizzo delle giunzioni di splicing. Esoni specifici possono essere esclusi o inclusi nel prodotto di RNA, a seconda che il processo utilizzi o meno una data coppia di giunzioni di splicing. Gli esoni possono essere estesi saltando una giunzione di splicing per utilizzarne una alternativa. Uno stesso gene può quindi codificare proteine diverse, dette isoforme: Il gene BAX ha 5 isoforme. In rosso sono indicati gli esoni codificanti, in blu gli UTR. Le linee sottili sono gli introni. Nella prima variante il 3' UTR è formato da parte del penultimo esone e da tutto l'ultimo esone, mentre nelle 3 varianti successive l'ultimo esone ha una parte codificante.

34 Esportazione dell'mRNA Gli mRNA maturi, provvisti di 5' cap, coda di Poli(A) e privi degli introni, vengono esportati dal nucleo nel citoplasma. Nel citoplasma avviene la traduzione, ovvero il processo di sintesi delle proteine a partire dai codoni specificati nella sequenza di mRNA.


Scaricare ppt "Bioinformatica Corso di Laurea specialistica in Informatica RNA: trascrizione e maturazione 21/03/2011."

Presentazioni simili


Annunci Google