La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

TRASCRIZIONE del DNA TRASCRIZIONE del DNA. DNA ---> RNA ---> Proteina TRASCRIZIONE TRADUZIONE.

Copie: 1
TRASCRIZIONE del DNA TRASCRIZIONE del DNA. DNA ---> RNA ---> Proteina TRASCRIZIONE TRADUZIONE.

Presentazioni simili


Presentazione sul tema: "TRASCRIZIONE del DNA TRASCRIZIONE del DNA. DNA ---> RNA ---> Proteina TRASCRIZIONE TRADUZIONE."— Transcript della presentazione:

1 TRASCRIZIONE del DNA TRASCRIZIONE del DNA

2 DNA ---> RNA ---> Proteina TRASCRIZIONE TRADUZIONE

3 La sintesi di RNA richiede uno stampo di DNA e procede da 5 --> 3 E mediata dalla RNA polimerasi

4 La sintesi di RNA utilizza come stampo la catena inferiore RNA risultante simile alla catena superiore 5 – ATTGGGCGCGATGGTTTATAGATCTACCCATAGTCTGC – 3 3 – TAACCCGCGCTACCAAATATCTAGATGGGTATCAGACG – 5 5 – AUUGGGCGCGAUGGUUUAUAGAUCUACCCAUAGUCUGC – 3

5 5 Regione regolatoria Regione trascritta3

6 EUCARIOTI il DNA genomico è organizzato in cromosomi nel nucleo presenza di istoni associati al DNA e formazione di cromatina la trascrizione avviene nel nucleo. La traduzione nel citoplasma dopo che l'RNA è maturato a messaggero (perdita degli introni, poliadenilazione, ecc.) PROCARIOTI non possiedono nucleo il DNA genomico è sparso nel citoplasma la trascrizione è accoppiata alla traduzione CONTROLLO SINTESI PROTEICA

7 CONTROLLO GENICO Nei PROCARIOTI serve per: - Adattare il batterio ai cambiamenti nutrizionali - divisione cellulare Negli EUCARIOTI serve per: - Regolare un programma genetico alla base dello sviluppo embrionale e del differenziamento cellulare e tissutale

8 CONTROLLO GENICO NEI PROCARIOTI nei batteri il controllo genico può avvenire: - a livello dell'inizio della trascrizione - a livello della terminazione della trascrizione - a livello del ricambio dell'RNA (stabilità dell'mRNA)

9 INIZIO DELLA TRASCRIZIONE NEI PROCARIOTI RNA polimerasi possiede 2 subunità uguali 2 subunità diverse e ' (legano il DNA aspecificamente) 1 subunità ω

10 PROTEINE ACCESSORIE della RNA polimerasi FATTORE aiuta l'RNA polimerasi a riconoscere sequenze specifiche del DNA a livello del promotore. Si conoscono diversi tipi di fattori : variano per i diversi promotori.

11 Il complesso RNA polimerasi con il Fattore si chiama OLOENZIMA Loloenzima legato al DNA separa la struttura a doppia elica e comincia a formare RNA sul templato di DNA Dopo linizio della trascrizione il fattore si stacca

12 INDUZIONE O REPRESSIONE DELLA TRASCRIZIONE GENICA BATTERICA SOSTANZE NUTRITIVE - induzione enzimatica: solo quando una determinata sostanza nutritiva e presente (oppure e assente) tempo Quantita di enzima velocita di sintesi dellenzima teorico sperimentale INDUZIONE / REPRESSIONE

13 OPERONI Vengono chiamati OPERONI dei geni in successione controllati da un unico promotore. L'OPERONE da origine ad un singolo RNA messaggero che viene detto POLICISTRONICO, perchè codifica più di una proteina (CISTRONE è l'unità genetica più piccola che codifica un solo peptide). I geni di un operone spesso codificano gli enzimi diversi di una sola via metabolica. Essi vengono così controllati in modo coordinato.

14 Ogni segmento codificante di un mRNA policistronico è tradotto in modo indipendente perché ogni porzione possiede il suo - SITO DI LEGAME PER IL RIBOSOMA, - il proprio CODONE DI INIZIO e - il proprio CODONE DI TERMINAZIONE.

15 Proteine X Y Z

16

17

18 OPERONE LAC

19 ASSENZA DI LATTOSIO - PRESENZA GLUCOSIO

20 PRESENZA DI LATTOSIO - PRESENZA DI GLUCOSIO

21 PRESENZA DI LATTOSIO - ASSENZA DI GLUCOSIO Lassenza di GLUCOSIO porta ad un AUMENTO dei LIVELLI di cAMP cAMP lega --> proteina attivatrice del catabolismo [CAP] --> azione attivatoria sul promotore

22

23 CONTROLLO DELLA TRASCRIZIONE NEI PROCARIOTI PROTEINE BATTERICHE STRUTTURALI (GENI STRUTTURALI) Sono in genere trascritte in modo COSTITUTIVO, a velocità più o meno costante, ed entrano a far parte di membrane, ribosomi, ecc. PROTEINE BATTERICHE REGOLATRICI (GENI REGOLATORI) - meno numerose - permettono di percepire le variazioni ambientali; - legano il DNA alterando la velocità di trascrizione dei geni strutturali in senso positivo o negativo. le proteine batteriche regolatrici si dividono in: REPRESSORI e ATTIVATORI

24 REPRESSORI DELLA TRASCRIZIONE GENICA REPRESSORI sono le proteine regolatrici ad azione negativa; impediscono il legame con dell'RNApolimerasi (oloenzima) al DNA, interagendo con determinate sequenze a livello del sito OPERATORE, spesso localizzato vicino al PROMOTORE. °°°°°°°°°°°°°°°°°°°°° i REPRESSORI possono combinarsi con piccole molecole dette EFFETTORI che influenzano l'affinità del legame del repressore con il DNA.

25 Gli EFFETTORI possono essere INDUTTORI o COREPRESSORI - gli INDUTTORI si combinano con il repressore e ne diminuiscono l'affinità di legame con il DNA. - i COREPRESSORI hanno il ruolo opposto, in tal caso il repressore funziona solo in presenza del suo effettore corepressore. R = repressore I = induttore CR = corepressore R(attivo) + I --> R-I(inattivo) NO TRASCRIZIONE R(inattivo) + CR --> R-CR (attivo) NO TRASCRIZIONE

26

27 ATTIVATORI DELLA TRASCRIZIONE GENICA ATTIVATORI sono le proteine regolatrici ad azione positiva; si legano al DNA interagendo con determinate sequenze a livello del sito PROMOTORE o vicino ad esso; aumentano la frequenza con cui l'RNA polimerasi (oloenzima) si lega al promotore. °°°°°°°°°°°°°°°°°°°°° anche gli ATTIVATORI possono utilizzare un EFFETTORE.

28 CONTROLLO COMPOSTO DELLA TRASCRIZIONE GENICA una diminuzione del GLUCOSIO porta alla produzione di: EFFETTORE --> AMP ciclico che lega e attiva una ATTIVATORE --> PROTEINA ATTIVATRICE del CATABOLISMO (CAP), che serve per molti geni diversi. L' OPERONE lac è sotto il controllo: positivo del complesso CAP-cAMP negativo della proteina repressore per il lattosio.

29

30 CONTROLLO DELLA TERMINAZIONE DELLA TRASCRIZIONE E' meno determinante di quello effettuato sull'inizio della trascrizione. Avviene alla fine di un gene su appositi SITI DI TERMINAZIONE ricchi di G e C. Alcune proteine funzionano da fattori di terminazione: es il FATTORE RHO (proteina specifica)

31 -TERMINAZIONE DIPENDENTE DAL FATTORE RHO la proteina (fattore RHO) forma un esamero su cui si avvolge l'RNA in formazione, provocandone il discacco dal DNA templato. - TERMINAZIONE INDIPENDENTE DAL FATTORE RHO:

32 EUCARIOTI

33 NUCLEOLO Sede della trascrizione degli RNA ribosomiali ed assemblaggio dei ribosomi

34 EUCROMATINA 90% cromatina decondensata dispersa nel nucleo --> consente la trascrizione dei geni ETEROCROMATINA 10% cromatina nello stato compattato --> non consente la trascrizione dei geni Alla MITOSI eucromatina eterocromatina

35 ISTONI Gli istoni, proteine cariche positivamente (aa basici), interagiscono con il DNA carico negativamente per i gruppi fosfato. Cinque tipi di istoni: 4 in doppio formano un ottamero intorno al quale il DNA si avvolge in modo sinistrorso chiamato nucleosoma, bloccato dallIstone H1

36

37 INIZIO TRASCRIZIONE NEGLI EUCARIOTI TRE tipi di RNA polimerasi (nei batteri solo 1) -RNA polimerasi I sintetizza RNA ribosomiale -RNA polimerasi II sintetizza gli mRNA -RNA polimerasi III sintetizza gli piccoli RNA (tRNA, RNA 5S)

38 RNA POLIMERASI E FATTORI DI TRASCRIZIONE I FATTORI DI TRASCRIZIONE sono proteine che facilitano l'interazione tra la RNA polimerasi ed il DNA. Si dividono in: -Fattori richiesti per l'inizio della trascrizione; -Fattori che aiutano il processo di allungamento dell'RNA da parte dell'RNA polimerasi; -Fattori che partecipano alla formazione di un complesso attivo di preinizio, che non sono più richiesti nelle fasi avanzate della trascrizione.

39 primi due sono FATTORI GENERALI necessari per la trascrizione di tutti i geni Gli ultimi sono FATTORI SPECIFICI, servono solo per particolari geni e corrispondono alle proteine regolatrici trovate nei procarioti.

40 Due fattori di trascrizione (UBF e SL1) si legano al promotore dellrDNA. Reclutano la RNA polimerasi I formando il complesso di inizio si legano al DNA che codifica i vari RNA ribosomiali ed aiutano la RNA polimerasi I SL1 e formata da diverse proteine associate al TBP (TATAbox binding protein) RNA Polimerasi I

41 Sintetizza gli RNA 5S (nucleoli e citoplasma) Sintetizza gli RNA transfer (tRNA) I promotori per questi due geni sono a valle del sito di inizio della trascrizione Sintetizza lsnRNA U6 Il suo promotore è a monte del sito di inizio della trascrizione RNA Polimerasi III

42 RNA 5S (nucleoli e citoplasma) Richiede TF III A legato a TF III B+TF III C RNApol III RNA transfer (tRNA) NON richiede TF III A ma solo TF III B+TF III C RNApol III snRNA U6 Richiede la TBP(TF II B)+SNAP

43 formazione degli trascritti primari di RNA La maggior parte degli mRNA (che derivano dalla maturazione del trascritto primario) è MONOCISTRONICA, quindi sono tutti controllati da un loro promotore specifico. L'RNA polimerasi II inizia la sintesi a livello del sito CAP. RNA Polimerasi II Il sito CAP e preceduto dal TATA box TATA box sequenza altamente conservata, collocata a circa nucleotidi a monte del sito CAP di inizio della trascrizione.

44 Promoter introni Sito CAP esoni Regioni upstreamRegioni downstream Eucarioti TATA box

45 La RNA polimerasi II richiede molti FATTORI DI TRASCRIZIONE diversi da quelli della I e della III. Il più importante è il TF II D, proteina di circa 100 Kda che lega il TATA box Il TF II D e composto dal TBP (TATAbox binding protein)+ TAF (TBP associated proteins) CONTROLLO DELLA TRASCRIZIONE NEGLI EUCARIOTI

46 La RNA polimerasi II richiede molti FATTORI DI TRASCRIZIONE diversi da quelli della I e della III. Il più importante è il TF II D, proteina di circa 100 Kda che lega il TATA box Il TF II D e composto dal TBP (TATAbox binding protein)+ TAF (TBP associated proteins) TF II B e TF II E aiutano il TF II D a legarsi al DNA, ma non possono legarsi da soli. TF II B si lega alla RNA polimerasi II anche da solo. Esistono poi molti altri fattori di trascrizione, tra cui TF II F, TF II H……….. CONTROLLO DELLA TRASCRIZIONE NEGLI EUCARIOTI FATTORI BASALI DELLA TRASCRIZIONE

47

48 Promoter introni Sito CAP esoni Regioni upstreamRegioni downstream Eucarioti TATA box

49 Promoter introni Sito CAP esoni Regioni upstreamRegioni downstream Eucarioti GC box - CAAT box (altri) TATA box

50 SEQUENZE PROSSIMALI DEL PROMOTORE Oltre al TATA box sono state identificate altre sequenze conservate a livello del promotore: GGGCG: lega una proteina chiamata SP1 (stimulatory protein 1) che attiva la trascrizione. CCAAT:lega una grossa famiglia di proteine regolatrici

51 Enhancers Elementi responsivi Promoter introni Sito CAP esoni Regioni upstreamRegioni downstream Eucarioti GC box - CAAT box (altri) TATA box

52 INTENSIFICATORI (Enhancers) Sequenze di DNA che legano proteine specifiche; se attivate possono aumentare la trascrizione genica basale anche di volte. Sono in genere collocate a monte del TATA box, a distanze variabili tra 100 e bp. A volte però, possono essere collocate anche a notevole distanza dal TATA box ( bp) o nel primo introne, o nella regione 3' non tradotta.

53 Enhancers Elementi responsivi Promoter introni Sito CAP esoni Regioni upstreamRegioni downstream Eucarioti GC box - CAAT box (altri) TATA box

54

55 5 3 esone COOH NH 2 DNA ORMONE HINGE N - terminale

56 responsive GENE ARE hsp T T DHT 5-RII mRNA new proteins RNA pol II TFIID E hystone acetyl transferase co-activators F B H TATA Mechanism of activation of the androgen receptor

57 Zn polyGln P PP P P A S P S P P=phosphorylation A=acetylation S=sumoylation Transactivation domain/(AF-1/AF-5) \ ID NLS AF-2 DNA binding domain H12 Hormone binding domain 5'-UTR Exon 1 Exon 2 Exon 3 Exon 4 Exons 5/6/7/8 3'-UTR (CAG) n Upstream ORF AUG 1 -UGA AUG 2 mRNA protein polyA

58 Zn polyGln P PP P P A S P S P Transactivation domain/(AF-1/AF-5) \ ID NLS AF-2 DNA binding domain H12 Hormone binding domain

59

60

61 (D-box) x 2

62 Claessens et al. Nuclear Receptor Signaling, 2008

63

64 Istone-acetil-trasferasi


Scaricare ppt "TRASCRIZIONE del DNA TRASCRIZIONE del DNA. DNA ---> RNA ---> Proteina TRASCRIZIONE TRADUZIONE."

Presentazioni simili


Annunci Google