La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Informatica e Bioinformatica – A. A. 2013-2014 1 Ripercorriamo velocemente i principali concetti di biologia indispensabili per capire la Bioinformatica:

Presentazioni simili


Presentazione sul tema: "Informatica e Bioinformatica – A. A. 2013-2014 1 Ripercorriamo velocemente i principali concetti di biologia indispensabili per capire la Bioinformatica:"— Transcript della presentazione:

1 Informatica e Bioinformatica – A. A Ripercorriamo velocemente i principali concetti di biologia indispensabili per capire la Bioinformatica: verranno approfonditi in altri corsi.  Gli organismi viventi possiedono tutti un genoma, il quale contiene tutta l’informazione biologica necessaria alla costruzione e alla sopravvivenza di un individuo.  L’informazione biologica contenuta in un genoma è codificata nell’acido deossiribonucleico (DNA) ed è suddivisa in unità discrete chiamate geni.  I geni codificano tutte (e non solo) le proteine di un organismo, comprese quelle che si legano in appropriati punti del genoma regolando una serie di reazioni definite espressione genica. Nozioni base di Biologia

2 Informatica e Bioinformatica – A. A Procarioti: organismi unicellulari con una organizzazione relativamente semplice. Non contengono particolari organelli, caratteristici degli eucarioti. Il materiale genetico (DNA) non è racchiuso in una particolare struttura. Gli Eucarioti hanno un nucleo, dove è contenuto il DNA, ed hanno dei compartimenti interni, racchiusi da membrane, chiamati organelli, che assolvono particolari compiti biologici (complesso del Golgi, lisosomi, mitocondri, ecc.). Procarioti ed Eucarioti

3 Informatica e Bioinformatica – A. A Gli acidi nucleici (DNA: acido deossiribonucleico e RNA: acido ribonucleico) sono dei polimeri organici costituiti da monomeri chiamati nucleotidi. I nucleotidi sono formati da tre elementi fondamentali:  un gruppo fosfato  una molecola di zucchero pentoso (deossiribosio nel DNA o ribosio nell’RNA)  una base azotata che si lega allo zucchero con legame N-glicosidico. Gli acidi nucleici sono formati solo da quattro tipi di basi azotate: adenina, guanina, citosina (comuni al DNA e all’RNA); la timina presente solo nel DNA; l’uracile solo nel RNA. Acidi nucleici: DNA e RNA

4 Informatica e Bioinformatica – A. A Il DNA esiste prevalentemente in forma di doppia elica antiparallela, in cui due filamenti sono appaiati e avvolti tra loro. Le basi si appaiano all’interno della doppia elica secondo la regola: Adenina con Timina (A-T) Guanina con Citosina (G-C) Due basi in grado di appaiarsi tra loro vengono dette complementari. Di conseguenza, se si conosce la sequenza di un’elica si può ricavare anche la sequenza dell’elica complementare. Nota: Negli eucarioti, il DNA si dispone all'interno del nucleo in strutture chiamate cromosomi. Negli altri organismi, privi di nucleo, esso può essere organizzato in cromosomi o meno e risiede nel citoplasma.

5 Informatica e Bioinformatica – A. A La direzionalità delle molecole di DNA 5' nn CGATGCTAGTAGTTGTACGCAnn -> 3‘OH ||||||||||||||||||||| HO-3‘<- nn GCTACGATCATCAACATGCGTnn - 5' Una rappresentazione in formato testo di una doppia elica di DNA 5‘-CGATGCCACCAAGTTGTACGCA-> 3‘OH Nota: il DNA può essere costituito da catene lunghissime di basi. Il genoma umano nei suoi 46 cromosomi, contiene circa 3.3 miliardi di basi!! La complementarietà delle basi consente di poter archiviare solo una delle due eliche di una molecola di DNA, che viene in genere rappresentata in direzione 5’ -> 3’ Qual è il numero di tipologie di basi azotate che vi attendete?

6 Informatica e Bioinformatica – A. A Le Proteine Fin dall'inizio del secolo scorso sappiamo che le proteine sono responsabili di molti processi biochimici. Le proteine sono polimeri lineari di aminoacidi, uniti chimicamente l'uno all'altro tramite legame peptidico. Le proteine sono costituite essenzialmente da 20 possibili aminoacidi diversi. La sequenza con cui gli aminoacidi si succedono l'uno all'altro determina le proprietà di ogni proteina. Esistono proteine di lunghezze molto diverse, da pochi aminoacidi (in questo caso sono generalmente chiamate peptidi) a diverse migliaia di aminoacidi. In una proteina la sequenza di aminoacidi ha una direzione. Per convenzione la sequenza si scrive a partire dall'estremità NH 2 -terminale (che è la prima ad essere sintetizzata) e si procede verso l’estremità COOH-terminale.

7 Informatica e Bioinformatica – A. A Strutture delle proteine Struttura primaria: sequenza degli aminoacidi Struttura terziaria: la struttura tridimensionale della proteina. Struttura quaternaria: determinata dal fatto che molte proteine sono costituite da più subunità. Struttura secondaria: le proteine tendono ad assumere conformazioni locali particolari molto comuni, come α-eliche e foglietti-β

8 Informatica e Bioinformatica – A. A Il dogma centrale della Biologia Duplicazione Porta alla formazione di nuove molecole di DNA e al trasferimento del materiale genetico. Trascrizione L’informazione contenuta nel DNA passa alle molecole di RNA. Traduzione Processo finale in cui dall’RNA si arriva alla sintesi delle proteine. Come l’informazione biologica presente nel genoma è “utilizzata” per la sintesi delle proteine?

9 Informatica e Bioinformatica – A. A La trascrizione del DNA Processo nel quale l’RNA (acido ribonucleico) è sintetizzato a partire dal DNA stampo. L’RNA è un acido nucleico, il cui scheletro contiene zucchero ribosio coniugato con le basi Adenina, Guanina, Citosina e Uracile (U, al posto di T). La sintesi dell’RNA avviene in direzione 5’  3’ ad opera di enzimi detti RNA polimerasi, che generano una copia ad RNA del DNA stampo. Le molecole prodotte possono essere diverse. Si distinguono (lista parziale) in:  RNA messaggero o mRNA  RNA transfer o tRNA  RNA ribosomali o rRNA ognuna delle quali è coinvolta, con ruoli diversi, nella sintesi proteica.

10 Informatica e Bioinformatica – A. A L’azione delle RNA polimerasi è in qualche modo “guidata”dalla presenza sul DNA di particolari box di sequenza che vengono riconosciuti da fattori di trascrizione. Non tutto il DNA viene trascritto in RNA. Alcune parti del DNA forniscono informazioni su:  inizio (segnale d’inizio) e fine (segnale di stop) della trascrizione;  regolazione della trascrizione (nello stesso organismo non tutti i geni sono trascritti in tutte le cellule)  promotori, repressori della trascrizione.

11 Informatica e Bioinformatica – A. A La struttura del gene La definizione di “gene” nel corso degli anni è cambiata (e continua a cambiare), ma possiamo comunque rimarcare una sostanziale differenza tra i geni dei procarioti e degli eucarioti. 5’UTR 3’UTR Nei procarioti Il gene corrisponde in genere all’intera sequenza presente nell’mRNA. L’mRNA include la porzione che corrisponde alla sequenza amminoacidica, che viene chiamata regione codificante (CDS), ma anche delle sequenze aggiuntive ad entrambe le estremità, non codificanti, indicate come 5’ UTR e 3’ UTR.

12 Informatica e Bioinformatica – A. A Generalmente i geni degli eucarioti (in particolare degli eucarioti superiori) sono interrotti da introni. Trascrizione: si genera il trascritto primario Maturazione dell’RNA Splicing degli introni (la loro eliminazione), e l’unione degli esoni a formare il trascritto maturo (RNA messaggero maturo). esoni introni Rappresentazione schematica del DNA genomico del gene della  -globina Messaggero maturo Negli eucarioti

13 Informatica e Bioinformatica – A. A >gi| |ref|NM_ | Homo sapiens myozenin 1 (MYOZ1), mRNA GTTTCTCCCTAAGTGCTTCTTTGGATCTCAGGCTCTAGGTGCAATGTGAAGGGGAGTCCCTGGGCAGACTGATCCCTGGCTCAGACAGTTC AGTGGGAGAATCCCAAAGGCCTTTTCCCTCCTTCCTGAGCCTCCGGGCAAGGAGGGAGGGATCTTGGTTCCAGGGTCTCAGTACCCCCTGT GCCATTTGAGCTGCTTGCGCTCATCATCTCTATTAATAACCAACTTCCCTCCCCCACTGCCAGTGCTGCCCCCACGCCTGCCCAGCTCGTG TTCTCCGGTCACAGCAGCTCAGTCCTCCAAAGCTGCTGGACCCCAGGGAGAGCTGACCACTGCCCGAGCAGCCGGCTGAATCCACCTCCAC AATGCCGCTCTCAGGAACCCCGGCCCCTAATAAGAAGAGGAAATCCAGCAAGCTGATCATGGAACTCACTGGAGGTGGACAGGAGAGCTCA GGCTTGAACCTGGGCAAAAAGATCAGTGTCCCAAGGGATGTGATGTTGGAGGAACTGTCGCTGCTTACCAACCGGGGCTCCAAGATGTTCA AACTGCGGCAGATGAGGGTGGAGAAGTTTATTTATGAGAACCACCCTGATGTTTTCTCTGACAGCTCAATGGATCACTTCCAGAAGTTCCT TCCAACAGTGGGGGGACAGCTGGGCACAGCTGGTCAGGGATTCTCATACAGCAAGAGCAACGGCAGAGGCGGCAGCCAGGCAGGGGGCAGT GGCTCTGCCGGACAGTATGGCTCTGATCAGCAGCACCATCTGGGCTCTGGGTCTGGAGCTGGGGGTACAGGTGGTCCCGCGGGCCAGGCTG GCAGAGGAGGAGCTGCTGGCACAGCAGGGGTTGGTGAGACAGGATCAGGAGACCAGGCAGGCGGAGAAGGAAAACATATCACTGTGTTCAA GACCTATATTTCCCCATGGGAGCGAGCCATGGGGGTTGACCCCCAGCAAAAAATGGAACTTGGCATTGACCTGCTGGCCTATGGGGCCAAA GCTGAACTTCCCAAATATAAGTCCTTCAACAGGACGGCAATGCCCTATGGTGGATATGAGAAGGCCTCCAAACGCATGACCTTCCAGATGC CCAAGTTTGACCTGGGGCCCTTGCTGAGTGAACCCCTGGTCCTCTACAACCAAAACCTCTCCAACAGGCCTTCTTTCAATCGAACCCCTAT TCCCTGGCTGAGCTCTGGGGAGCCTGTAGACTACAACGTGGATATTGGCATCCCCTTGGATGGAGAAACAGAGGAGCTGTGAGGTGTTTCC TCCTCTGATTTGCATCATTTCCCCTCTCTGGCTCCAATTTGGAGAGGGAATGCTGAGCAGATAGCCCCCATTGTTAATCCAGTATCCTTAT GGGAATGGAGGGAAAAAGGAGAGATCTACCTTTCCATCCTTTACTCCAAGTCCCCACTCCACGCATCCTTCCTCACCAACTCAGAGCTCCC CTTCTACTTGCTCCATATGGAACCTGCTCGTTTATGGAATTTGCTCTGCCACCAGTAACAGTCAATAAACTTCAAGGAAAATGAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA Nell’mRNA sono presenti anche regioni non tradotte Solo la parte centrale (in blu e sottolineata) codifica la relativa proteina (MYOZENIN 1). La regione a monte è la 5’UTR, la regione a valle la 3’UTR. Sequenza di un trascritto (MYOZ 1), in formato FASTA, ottenuta interrogando un database di sequenze nucleotidiche

14 Informatica e Bioinformatica – A. A Durante lo splicing, gli esoni degli eucarioti possono essere combinati (riarrangiati) in modi diversi tra loro. Si ottengono così differenti mRNA che codificano differenti proteine a partire dallo stesso gene. Questo meccanismo consente di amplificare la quantità di informazione contenuta nel genoma. Nell’uomo si stimano circa geni che, con questo meccanismo, possono codificare più di differenti proteine. Esempio di splicing alternativo L’uso alternativo dello splicing nel gene dei vertebrati per la calcitonina/CGRP, genera un ormone che regola l’omeostasi del calcio nella ghiandola tiroide (in verde) o un neuropeptide vasodilatatore nel sistema nervoso (in rosso). Solo negli eucarioti Splicing alternativo Come passare dagli mRNA alle proteine?

15 Informatica e Bioinformatica – A. A La traduzione (translation) L’informazione codificata nell’mRNA, utilizzando “solo” 4 tipi di nucleotidi deve poter generare ben 20 differenti aminoacidi. Consideriamo la sequenza lineare di RNA: 5-AUGAUCAGAAUCG……3  Se leggiamo 1 base alla volta (A, U, G, A, U, C,…….) esisterebbero solo 4 aminoacidi  2 basi (AU, GA, UC, AG,……): 4 2 combinazioni = 16 aminoacidi, non basta!  3 basi (AUG, AUC, AGA,…...): 4 3 combinazioni = 64 aminoacidi, anche troppi, ma è proprio così. La cellula possiede un sistema di interpretazione di questo codice genetico. La regione codificante è letta tre basi alla volta, senza sovrapposizioni: ogni gruppo di tre basi è chiamato tripletta o più propriamente codone. Tutti gli organismi hanno essenzialmente lo stesso codice genetico con qualche piccola eccezione in casi molto particolari (ad esempio i mitocondri): - è perciò definito universale.

16 Informatica e Bioinformatica – A. A  Le quattro lettere sulla colonna di sinistra indicano la prima base di ogni codone, le lettere poste in alto indicano la seconda base.  All'interno della tabella, accanto ad ogni codone è indicato l'aminoacido corrispondente.  Si può vedere che molti aminoacidi sono codificati da più codoni: il codice genetico è degenere perché molti amminoacidi sono codificati da più di un codone.  Tre codoni codificano lo "STOP", ovvero la fine della proteina.  Il codone ATG codifica la metionina ma indica anche l’inizio della regione codificante la proteina. Come leggere il codice genetico Questo significa che, noto un mRNA, potete in linea di principio ottenere la corrispondente sequenza amminoacidica!

17 Informatica e Bioinformatica – A. A Ad esempio la sequenza: A C T G T A C C G T T A A G C A T A…. può dare origine a: ACT GTA CCG TTA AGC ATA…... CTG TAC CGT TAA GCA TA….. TGT ACC GTT AAG CAT A…. Data la sequenza di un trascritto esistono tre possibili modi di tradurre tale sequenza in proteina, a seconda del punto di inizio: le tre possibilità sono chiamate reading frame (fasi di lettura). evidenza che la sequenza deve essere codificante Quando la fase di lettura è costituita esclusivamente da codoni che rappresentano aminoacidi si parla di open reading frame (ORF). Una sequenza tradotta in proteina ha una fase di lettura che comincia con un codone di inizio (in genere AUG) e si estende lungo i codoni finché raggiunge uno dei tre codoni di terminazione. In genere, solo una delle tre possibili fasi di lettura è aperta in una data sequenza di DNA. Una lunga open reading frame è difficile che sia presente per caso. Se non fosse tradotta non ci sarebbe nulla che impedisce l’accumulo dei codoni di terminazione:

18 Informatica e Bioinformatica – A. A Lo sviluppo di tecnologie strumentali sempre più sofisticate ha portato ad una enorme produzione di dati biologici. Per la gestione di questi dati è quindi necessario disporre di potenti sistemi di archiviazione e strumenti per accedere alle loro informazioni. DATABASE BIOLOGICI Sono essenzialmente dei contenitori ordinati di informazioni costruiti per introdurre e mantenere dati di tipo biologico e permetterne una facile consultazione ( query ) Raccolgono informazioni e dati derivati dalla letteratura e da analisi effettuate in laboratorio oppure attraverso l’applicazione di analisi bioinformatiche o analisi in silico. Sono generalmente accessibili liberamente e possono essere consultati via web. Ogni banca dati è caratterizzata da un elemento centrale attorno al quale viene costruita la entry della banca dati. Ad esempio, l’elemento centrale per le banche dati di sequenze di acidi nucleici è la sequenza nucleotidica di DNA o di RNA

19 Informatica e Bioinformatica – A. A L’oggetto principale è la ENTRY, una unità riconoscibile grazie ad un identificatore univoco, che possiede una descrizione organizzata in campi standardizzati riconoscibili grazie ad HEADERS (“etichette”), univoci nella banca dati; esempio Identificatore, Autore, Data, ecc. Organizzazione di un database biologico Un RECORD biologico  LOCUS un codice  DEFINITION descrizione della sequenza  ACCESSION un codice  ORGANISM l’organismo a cui appartiene la sequenza (e tassonomia)  REFERENCE Riferimenti bibliografici a quella sequenza o chi l’ha sottomessa

20 Informatica e Bioinformatica – A. A In genere le banche dati presentano 2 versioni delle entries: Flat-file: un file di testo semplice, formattato, meno “accessibile” HTML (o XML): interattivo, di facile consultazione L’interattività ha un ruolo centrale per una banca dati: permette di navigare facilmente tra le sue entries e quelle di altri database. Sia i flat-file che le pagine HTML sono ricchi di cross-references, riferimenti che rimandano ad altre banche dati generiche o specializzate. Si ottiene così per ogni entry una serie di informazioni spesso ridondanti, tra cui è bene sapersi orientare, anche perché alcune sembrano in contraddizione. Esempi: - una proteina può avere dei riferimenti a sequenze codificanti diverse; - una entry può avere più nomi per descriverla o corrispondere a più autori.

21 Informatica e Bioinformatica – A. A Collegamenti tra i database Caratteristica importante di questi database è il fatto che sono collegati (in modo intricato) tra di loro. Da un record di un database è possibile saltare, mediante un link ipertestuale, ai record ad esso correlati degli altri database integrati nel sistema.

22 Informatica e Bioinformatica – A. A Tipologie di interrogazioni delle Banche Dati RICERCHE TESTUALI (QUERY) Utilizzano programmi di RETRIEVAL (di ricerca, reperimento dati) per restituire i record di un database che soddisfano i criteri richiesti.  sfruttano una ricerca di tipo letterale ed individuano termini uguali. Ricordo che i database devono essere tutti standardizzati (tag, separatori, headers, segni di punteggiatura ecc): questo rende rapida la ricerca. RICERCHE PER SIMILARITÀ (su sequenze nucleotidiche o proteiche) Restituiscono le sequenze di un database più simili ad una sequenza fornita come query. Non sono delle vere e proprie query in quanto richiedono l’esecuzione di programmi anche piuttosto complessi (ad esempio BLAST o FASTA). Domande: Trovare la sequenza nucleotidica del gene ‘telethonin’ è una ricerca testuale o di similarità? Identificare in topo il gene omologo alla DHFR umana è una ricerca testuale o di similarità? Ricercare una sequenza proteica di homo sapiens è una query o una ricerca per similarità?

23 Informatica e Bioinformatica – A. A OPERATORI BOOLEANI Questi potreste già conoscerli dalla matematica! ATTENZIONE! Oltre a quello nucleare, esiste anche il genoma mitocondriale, nei database sono depositate sequenze derivanti da entrambe le sorgenti!!!

24 Informatica e Bioinformatica – A. A RICERCA BIBLIOGRAFICA Le modalità con cui si esegue una ricerca bibliografica sono di esempio per una qualsiasi ricerca testuale o query. Struttura di un articolo scientifico - Rivista dove è pubblicato (nome, data di pubblicazione, volume, pagina ) - Titolo - Autori - Abstract (Riassunto dell’articolo) - Introduzione - Opzionali: ringraziamenti - Reference (Bibliografia) Materiali e metodi Risultati, discussione, conclusione Descrizione del lavoro

25 Informatica e Bioinformatica – A. A Titolo Autori Abstract (riassunto) Introduzione Risultati

26 Informatica e Bioinformatica – A. A Discussione

27 Informatica e Bioinformatica – A. A Materiali e metodi References (citazioni) Informazioni supplementari in rete Correzioni


Scaricare ppt "Informatica e Bioinformatica – A. A. 2013-2014 1 Ripercorriamo velocemente i principali concetti di biologia indispensabili per capire la Bioinformatica:"

Presentazioni simili


Annunci Google