La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Teorie sullorigine degli introni e dei geni Francesco Piva Istituto di Biologia e Genetica.

Presentazioni simili


Presentazione sul tema: "Teorie sullorigine degli introni e dei geni Francesco Piva Istituto di Biologia e Genetica."— Transcript della presentazione:

1 Teorie sullorigine degli introni e dei geni Francesco Piva Istituto di Biologia e Genetica

2 Semplici mutazioni non costituiscono eventi di ricombinazione molto efficienti La probabilità che nel DNA si crei una certo motivo di lunghezza N è di 1/4^N, ovvero occorrono 4^N mutazioni puntiformi diverse per creare una parola di lunghezza N Es: ACCGT comparirebbe dopo in media 1024 mutazioni puntiformi casuali Se consideriamo un esone lungo 120 basi, questo dovrebbe essere comparso dopo circa 1,7^72 mutazioni Considerando che il tasso di mutazione nelluomo è di 10^-8 per sito per generazione, si deve ammettere che o gli esoni erano preesistenti nelle prime specie o la ricombinazione non si è basata solamente sulle mutazioni puntiformi.

3 La presenza degli introni migliorerebbe la ricombinazione Se non ci fossero introni, il massimo effetto di una mutazione singola sarebbe quello di sostituire un amminoacido. In presenza di introni, mutazioni che cadono nei siti di splicing possono alterare lo schema dello splicing, aggiungendo, sostituendo o eliminando molti amminoacidi alla volta. In questo modo, a parità di eventi di mutazione, si genererebbero nuove proteine con più rapidità. (Gilbert W. Why genes in pieces? NATURE :501)

4 Ulteriori vantaggi della presenza degli introni A parità di eventi di crossing over durante la meiosi, se un gene non avesse introni esso avrebbe unoccupazione cromosomica molto limitata. Solo se il crossing over avvenisse in modo da tagliare il gene genererebbe variabilità. Se il gene fosse diviso in esoni e quindi questi si trovassero distribuiti lungo il cromosoma, aumenterebbe la probabilità di scambio fra gli esoni. Consideriamo un evento di crossing over che coinvolga un tratto di 30Kb su un tratto di 100Kb Se il gene senza introni, si trovasse allinterno della zona scambiata, non ci sarebbe ricombinazione tra parti interne del gene.

5 Se il gene avesse una struttura interrotta, ci sarebbe maggior probabilità di avere ricombinazioni tra gli esoni.

6 Ricombinazione e splicing alternativo In presenza di una struttura interrotta, mutazioni neutre possono originare nuove forme di alternative splicing senza distruggere le forme funzionali già esistenti. Questa rappresenta unopportunità per levoluzione di esplorare nuovi schemi aggiungendoli eventualmente a quelli precedenti. (Pagani F, Raponi M, Baralle FE. Synonymous mutations in CFTR exon 12 affect splicing and are not neutral in evolution Proc Natl Acad Sci U S A May 3;102(18): )

7 Ricombinazione in Drosophila Ricordiamo che il centiMorgan o unità di mappa è lunità di misura in base alla quale viene espressa la distanza di due geni su un cromosoma e la lunghezza dei cromosomi nelle mappe genetiche. Un'unità di mappa corrisponde alla distanza di due geni che presentano una frequenza di crossing over dell'1%, e, quindi, ad un tratto di cromosoma nel quale in media si verifica un crossing-over ogni 50 meiosi. Assumiamo che la selezione naturale sia meno efficace in zone a basso tasso di ricombinazione. Analizzando la relazione tra le dimensioni degli introni in Drosophila e il tasso di ricombinazione delle zone in cui si trovano, si è evidenziata una correlazione. In generale si osserva che introni di dimensioni maggiori si trovano in zone di minor tasso di ricombinazione. Questo è spiegato con il fatto che introni lunghi hanno una maggior difficoltà nel subire splicing. Successivamente gli introni sono stati divisi in tre classi a seconda delle dimensioni, precisamente quelli aventi lunghezza minore di 60bp, quelli compresi tra 60 bp e 80 bp e quelli maggiori di 80bp. Si evidenzia che la classe di dimensioni intermedie si trova in zone ad alto tasso di ricombinazione e nella classe di sequenze di minor dimensione, la lunghezza degli introni e il tasso di ricombinazione sono proporzionali. Quindi anche introni molto corti si trovano in zone a bassa ricombinazione. (è meglio non toccare gli introni molto corti e quelli molto lunghi) Questi risultati sono in accordo con losservazione che in Drosophila introni di dimensioni minori di 60 bp e maggiori di 80 bp, non hanno una buona efficienza di splicing. (ANTONIO BERNARDO CARVALHO, ANDREW G. CLARK Genetic recombination: Intron size and natural selection Nature , 344)

8 Secondo questa osservazione, geni che si trovano in zone a basso tasso di ricombinazione dovrebbero essere penalizzati dal punto di vista dellevoluzione, ma questo è compensato dalla presenza di introni più lunghi, che rendono il gene più sparso e ristabiliscono un buon tasso di ricombinazione. Questi risultati sono in accordo con losservazione che in Drosophila introni di dimensioni minori di 60 bp e maggiori di 80 bp, non hanno una buona efficienza di splicing.

9 Teoria degli introni antichi (intron early) Originariamente esistevano piccole porzioni di genoma codificanti per altrettanto piccoli peptidi aventi funzioni semplici. Queste sequenze erano gli esoni e si trovavano molto lontane tra loro e allinterno di sequenze introniche. Eventi di ricombinazione non omologa a carico degli introni, avrebbero portato con se gli esoni, avrebbero avvicinato più esoni portandoli sotto il controllo dello stesso promotore. Questi eventi di rimescolamento (exon shuffling) avrebbero originato proteine più lunghe e complesse unendo i domini codificati dai singoli esoni. Evidenze a favore della teoria Il primo esempio di rimescolamento esonico è quello del gene che codifica per il recettore delle lipoproteine a bassa densità (LDL). La natura multifunzionale di questa proteina corrispondeva alla presenza di domini multipli, infatti dei 18 esoni che compongono questo gene, molti sono omologhi a sequenze di altre proteine. Precisamente 5 esoni codificano per domini simili a quelli della proteina del complemento C9, 3 producono domini simili a quelli del gene del precursore per il fattore di crescita dellepidermide (EGF), 3 generano domini simili alle proteine di coagulazione del sangue (fattore IX, X e proteina C). La proteina di questo recettore sembra essere generata da un mosaico di esoni condivisi con diverse proteine quindi appartiene a molte famiglie supergeniche. (Südhof, T C; Goldstein, J L; Brown, M S; Russell, D W The LDL receptor gene: a mosaic of exons shared with different proteins Science Vol 228, Issue 4701, 1985) Conservazione tra gli amminoacidi in tre specie nel gene LR11, le percentuali indicano le identità tra i vari domini ( Sonja Mörwald; Hiroyuki Yamazaki; Hideaki Bujo; Jun Kusunoki; Tatsuro Kanaki; Kouichi Seimiya; Nobuhiro Morisaki; Johannes Nimpf; Wolfgang Johann Schneider; Yasushi Saito. A Novel Mosaic Protein Containing LDL Receptor Elements Is Highly Conserved in Humans and Chickens. Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17: )

10 Sono state individuate altre proteine di struttura modulare che hanno sostenuto lipotesi dellexon shuffling. Precisamente tra tutte le proteine di una specie, sono state selezionate quelle i cui esoni corrispondevano a singoli e ben definiti domini proteici, inoltre tali esoni dovevano essere fiancheggiati da introni che non interrompevano la fase. Infatti solo questi introni potevano partecipare al rimescolamento degli esoni. I gruppi di proteine che corrispondevano a questi criteri erano principalmente: le selettine, il recettore dellinterleuchina 2, una subunità del fattore di coagulazione XIIIb, follistatina e alcune proteine inibitrici della coagulazione

11 Evidenze che minano la teoria Confrontando i geni di proteine modulari tra specie diverse, si nota che luomo rispetto a Drosophila e Caenorhabditis, ha un maggior numero di introni. In questi casi, gli autori, pur attribuendo ancora allexon shuffling lorigine di tali proteine, giustificano la mancanza di introni delle specie non umane con la perdita dovuta a pressione selettiva durante levoluzione I blocchi colorati costituiscono i domini proteici e non gli esoni, la barra nera verticale corrisponde al dominio transmembrana. I numeri indicano la fase degli introni presenti nel gene. (László Patthy Genome evolution and the evolution of exon-shuffling a review GENE vol 238, 1999)

12 Diffusione tra i Phyla dei resti dei possibili eventi di exon shuffling Analizzando le proteine modulari (definite come quelle aventi almeno un esone coincidente con un modulo proteico fiancheggiato da almeno un altro modulo, e il cui esone nel gene si trova tra introni inseriti in fase 1) tra tutti i genomi possibili, si nota che queste sono presenti in differenti phyla tra cui: le spugne, gli idrozoi, i nematodi, i molluschi, gli artropodi e gli echinodermi. Questo indica che il meccanismo dellexon shuffling era funzionante prima della divergenza del phylum dei metazoi. Inoltre la maggior frequenza di exon shuffling coincide con laumento del numero di specie che si è avuto al tempo della radiazione dei metazoi, attribuendo ad accelerare levoluzione dei metazoi. Al contrario esistono proteine a struttura modulare presenti solamente nella linea dei cordati, ma anche in questo caso buona parte dei domini corrispondono agli esoni, e tali domini sono ritrovati in proteine di specie più antiche. Queste osservazioni sono ben giustificate dallexon shuffling.

13 La maggior parte delle proteine modulari che sarebbero state prodotte dallexon shuffling, sono legate a funzioni essenziali alla multicellularità dei metazoi, come ad esempio alcuni costituenti della matrice extracellulare, mediatori e recettori per la comunicazione tra cellule, proteine per linterazione matrice-cellula. Quindi lexon shuffling avrebbe permesso e accelerato levoluzione dei metazoi multicellulari.

14 Una più ampia valenza Eventi di exon shuffling si possono osservare anche in alcune piante, così da assegnargli una valenza generale tra le specie per la creazione di nuovi geni. Come sarebbe avvenuto lexon shuffling Sono stati proposti due meccanismi per spiegare come possa avvenire lexon shuffling. Uno consiste nella ricombinazione illegittima, cioè nella ricombinazione di sequenze di DNA sia omologhe che non omologhe o meglio nella saldatura, a seguito di rotture, di lembi di DNA che non erano originariamente uniti insieme. Laltro consiste in una ricombinazione mediata dalle LINE-1, questi elementi, molto abbondanti nei genomi dei mammiferi, sono in grado di duplicarsi con un meccanismo copia e incolla. E stato dimostrato che tali elementi possono trascrivere oltre a se stessi anche una zona genomica a valle di essi, portandola con se anche nella retrotrasposizione. Esso sarebbe responsabile del rimescolamento di parti del genoma e quindi anche di esoni.

15 Un esempio di origine di un gene per retroposizione è dato dal gene BC200 del cromosoma 2 che si trova espresso nel cervello dei primati. In questo gene si possono riconoscere tre parti: quella in 5 corrisponde ad un ALU, la parte centrale è una ripetizione di molte A e la parte in 3 coincide con parte di una sequenza LINE. ALU FLAM-C1 Poly A LINE L1 5 3 (Tiedge H, Chen W, Brosius J Primary structure, neural-specific expression, and dendritic location of human BC200 RNA J Neurosci Jun;13(6))

16 Tracce caratteristiche di eventi di retroposizione sono la perdita di introni, la presenza di tratti di poly A e la presenza di ripetizioni corte. Riportiamo un esempio relativo a un evento di retroposizione che ha duplicato un intero gene conservando la struttura introni-esoni. E il caso del gene PMCHL1 che corrisponde come posizione ad un introne del gene AROM (antisense- RNA-overlapping-MCH) ma si trova nel filamento opposto. Mostriamo la locazione originale del gene PMCHL1 (cromosoma 5 posizione – ), si nota che nellaltro filamento è presente un introne di un altro gene. mostriamo la retroposizione nello stesso cromosoma ma alla posizione –

17 In generale riportiamo uno schema che riassume il meccanismo di retroposizione, mediante retrotrascrizione, per cui un gene viene copiato e incollato in unaltra posizione portando con se un altro gene che conserva ancora la struttura introni-esoni. Meccanismo generale di retroposizione che conserva la struttura introni-esoni mediante retrotrascrizione. Le frecce e le bandierine ovali indicano rispettivamente linizio e la fine della trascrizione

18 La teoria dellintron late Secondo la teoria dellintron late, geni piuttosto lunghi esistevano già nel passato, gli introni si sarebbero inseriti successivamente, il loro inserimento sarebbe avvenuto in fasi e posizioni casuali quindi tali da non definire moduli proteici, ovvero non si dovrebbe trovare una corrispondenza tra esone e dominio proteico (o tra introni e confini dei moduli proteici). Al contrario lexon shuffling produce geni più complessi se il rimescolamento avviene aggiungendo un esone avente la stessa fase dei fiancheggianti e lunghezza multipla di tre. Questo significa trovare esoni fiancheggiati da introni di fase identica. Se linserimento di un esone alterasse il frame di lettura proprio o dei successivi esoni, si potrebbero produrre codoni di STOP prematuri e originare proteine tronche anziché allungate e presumibilmente più complesse.

19 E1 E2 2 2 E1 + E2 + E3 E1 E2 2 0 STOP E1 + E2 tronco E3 2 E1 E3 2 2 E1 + E3 Situazione originale prima che lo shuffling inserisca lesone 2 2 n n Caso in cui lesone 2 ha la stessa fase degli esoni tra i quali si inserisce Caso in cui lesone 2 ha fase diversa rispetto agli esoni tra i quali si inserisce La prima situazione si riferisce ad un gene composto dagli esoni E1 e E3. Si suppone che tramite exon shuffling avvenga linserzione di un esone (E2) tra i due esoni preesistenti. Nel caso in cui lesone inserito, abbia la stessa fase del punto in cui avviene linserimento, esso contribuirà a creare un prodotto proteico più lungo e presumibilmente più complesso. Nel caso in cui lesone inserito abbia fase diversa rispetto allinserzione, poiché cambierebbe il frame di lettura dellesone 2, questo potrebbe manifestare un codone di STOP prematuro e troncare la proteina anziché allungarla. In aggiunta, se la lunghezza dellesone 2 è tale per cui viene cambiata anche il frame di lettura degli esoni a valle dellinserzione, aumenta la probabilità di trovare un codone di STOP prematuro. Questo spiega perché esoni fiancheggiati da introni di fase identica, sono più probabilmente dovuti allexon shuffling.

20 Unaltra prova a sostegno dellexon shuffling In un lavoro che ha utilizzato tecniche bioinformatiche, sono stati raccolti molti geni antichi, definendo come antichi quelli condivisi tra più specie. Viene osservata la fase di tutti gli introni ottenendo che la percentuale di introni in fase 0 era il 48%, quelli in fase 1 del 30% e quelli in fase 2 del 22%. Applicando la formula dellabbondanza relativa alle associazioni tra due fasi introniche, si riesce ad evidenziare se certe associazioni di fasi introniche sono favorite o sfavorite. Precisamente definiamo ad esempio R(12) come labbondanza relativa di introni fiancheggianti lo stesso esone, rispettivamente in fase 1 e 2 dove F(1) è la frequenza osservata di tutti gli introni in fase 1 nel campione di geni analizzati, F(12) è la frequenza osservata della coppia di introni (fiancheggianti lo stesso esone) in fase 1 e 2. Questa formula presenta a numeratore la frequenza osservata e a denominatore quella attesa. Ci aspettiamo valori di R tanto più diversi da 1 quanto più esistono associazioni non casuali tra due introni vicini. Applicando questa formula a tutte le 6 possibili combinazioni di fase intronica gli autori osservano una prevalenza di coppie di introni di fase identica rispetto a quella aspettata. Inoltre si osserva che lassociazione in cui entrambi gli introni si trovano in fase 1 è quella favorita su tutte. Tale studio rafforzerebbe la validità dellexon shuffling, affermando che le coppie di introni con la stessa fase sarebbero i residui dellexon shuffling mentre le altre sarebbero derivate da eventi di inserzione intronica. (Long M, Rosenberg C, Gilbert W. Intron phase correlations and the evolution of the intron/exon structure of genes Proc Natl Acad Sci U S A Dec 19;92(26))

21 Proviamo a mettere in discussione quello appena detto Una spiegazione alternativa a queste osservazioni è che i siti di proto-splice, cioè quei siti nei quali gli introni si possono inserire, si trovino già essi stessi distribuiti nelle tre fasi con diversa probabilità. Quindi se gli introni avessero una distribuzione casuale tra i siti di proto-splice, la loro distribuzione seguirebbe quella dei siti di proto-splice. Definendo la tripletta AG|G come sito di proto splice, è stata indagata la distribuzione degli introni su tutti i possibili siti AG|G. Si è osservato che gli introni non sono equamente distribuiti tra i siti di proto-splice, rendendo così ancora valida lipotesi dellexon shuffling. (N.J. Dibb and A.J. Newman, Evidence that introns arose at proto-splice sites. EMBO J 8 (1989)) (N.J. Dibb, Proto-splice site model of intron origin. J Theor Biol 151 (1991)) (J.M. Logsdon, Jr, The recent origins of spliceosomal introns revisited. Curr Opin Genet Dev 8 (1998)) (J.M. Logsdon, Jr, A. Stoltzfus and W.F. Doolittle, Molecular evolution: recent cases of spliceosomal intron gain?. Curr Biol 8 (1998)) (M. Long, S.J. de Souza, C. Rosenberg and W. Gilbert, Relationship between proto-splice sites and intron phases: evidence from dicodon analysis. Proc Natl Acad Sci USA 95 (1998)) (M. Long and C. Rosenberg, Testing the proto-splice sites model of intron origin: evidence from analysis of intron phase correlations. Mol Biol Evol 17 (2000))

22 Pseudo geni come punti di partenza per esplorare nuove proteine Il modello classico per spiegare lorigine di nuove strutture proteiche prevede che da un gene si possano originare delle copie così mentre una copia mantiene la funzione originale, laltra è libera di accumulare mutazioni e poter evolvere. Naturalmente la copia di un gene potrebbe subire vari destini: perdere funzionalità e diventare uno pseudo-gene, rimanere immutata e quindi costituire la ridondanza del gene originale oppure evolvere verso nuove e più complesse funzioni. Gli pseudo-geni si dividono in processati e non processati. Quelli processati si trovano su diversi cromosomi rispetto alla copia originale, non hanno introni, terminano spesso con delle adenine, sono fiancheggiati da ripetizioni e si trovano solo nei mammiferi. Quelli non processati, si trovano sullo stesso cromosoma del gene originale, hanno introni, hanno delle mutazioni che fanno comparire dei codoni di STOP prematuri o eliminare codone di inizio della traduzione originale, possono produrre un mRNA tronco o intero e si possono trovare in varie specie. Un esempio di nuovi geni funzionali evoluti da un gene originale è quello dellemoglobina umana, infatti ne esistono varie copie ma espresse in diversi stadi dello sviluppo. (L. J. Gibson PSEUDOGENES AND ORIGINS Origins 21(2): (1994)

23 Fattore di trascrizione dellRNA polimerasi II, gene originale che si trova nel cromosoma X. P.J. Wang, D.C. Page, Functional substitution for TAFII250 by a retroposed homolog that is expressed in human spermatogenesis. Human Molecular Genetics, 2002, Vol.11, No.19, Questo gene viene detto TAF I like e può sostituire TAF I durante la meiosi maschile quando i cromosomi sessuali sono trascrizionalmete silenti. Si trova nel cromosoma 9.

24 Critiche allexon shuffling Altrettanti geni antichi come quelli dellalcool deidrogenasi, globine, piruvato chinasi non mostrano una coincideza tra gli esoni e i moduli della struttura delle proteine. (Stoltzfus A, Spencer DF, Zuker M, Logsdon JM Jr, Doolittle WF - Testing the exon theory of genes: the evidence from protein structure Science Jul 8;265(5169)) fugu ATGTGTGACGACGACGAGACCACTGCCCTTGTGTGTGATAATGGCTCTGGCCTGGTCAAG canis ATGGATGACGA------TATCGCTGCGCTTGTGGTCGACAACGGCTCCGGCATGTGCAAG rat ATGTGTGACGAGGACGAGACCACCGCTCTTGTGTGTGACAACGGCTCTGGCCTGGTGAAA human ATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAG mouse ATGTGTGAAGAGGAAGACAGCACAGCCCTGGTGTGCGACAATGGCTCTGGGCTCTGTAAG gallus ATGTGTGAGGAGGAGGACAGCACTGCCCTTGTTTGTGACAATGGCTCAGGGCTCTGTAAA Xenopus ATGTGTGACGATGAAGAGACTACCGCACTTGTGTGTGACAATGGCTCCGGACTTGTAAAA danio ATGTGTGACGACGACGAGACTACCGCCCTTGTGTGCGACAACGGTTCCGGCCTGGTGAAG anopheles ATGTG---CGACGAAGAGGTTGCTGCGCTGGTTGTCGACAACGGATCCGGTATGTGCAAG drosophila ATGTGT---GACGAAGAAGTTGCTGCTCTGGTTGTCGACAACGGCTCTGGCATGTGCAAG scerevisiae ATGTGT---GACGACGATGTTGCCGCTCTCGTAGTTGACAATGGATCCGGAATGTGCAAA celegans ATGTGT---GACGACGATGTTGCCGCTCTCGTAGTTGACAATGGATCCGGAATGTGCAAA fugu GCTGGCTTTGCAGGCGATGATGCCCCCAGGGCTGTGTTCCCCTCCATTGTGGGACGCCCC canis GCCGGCTTCGCAGGCGACGACGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCC rat GCTGGCTTTGCCGGGGATGATGCCCCCAGGGCTGTGTTCCCATCCATCGTGGGTCGGCCC human GCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCC mouse GCCGGCTTCGCTGGTGATGATGCTCCCAGGGCTGTTTTCCCATCCATCGTGGGACGTCCC gallus GCTGGCTTCGCCGGGGATGATGCTCCAAGAGCAGTTTTCCCTTCCATCGTGGGTCGTCCC Xenopus GCTGGGTTCGCTGGAGATGATGCTCCAAGAGCAGTGTTTCCATCTATTGTTGGACGCCCC danio GCTGGCTTTGCTGGTGATGACGCCCCCAGAGCCGTCTTCCCCTCCATCGTTGGTCGCCCC anopheles GCCGGCTTTGCTGGGGATGACGCACCACGTGCCGTCTTCCCGTCCATCGTTGGACGCCCC drosophila GCCGGATTTGCCGGAGACGATGCTCCCCGCGCCGTCTTCCCATCGATTGTGGGACGTCCC scerevisiae GCTGGATTCGCTGGAGACGACGCTCCACGCGCCGTGTTCCCATCCATTGTCGGAAGACCT celegans GCTGGATTCGCTGGAGACGACGCTCCACGCGCCGTGTTCCCATCCATTGTCGGAAGACCT

25 fugu CGTCACCAG-X-GGTGTAATGGTCGGCATGGGCCAGAAAGATTCCTATGTGGGCGACGAG canis CGGCACCAG-X-GGCGTGATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGATGAG rat CGTCACCAG-X-GGTGTCATGGTCGGTATGGGTCAGAAGGATTCCTACGTGGGCGACGAG human AGACATCAG-X-GGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAA mouse AGACATCAG-X-GGAGTAATGGTTGGAATGGGCCAAAAAGACAGCTATGTGGGGGATGAA gallus AGGCACCAG-X-GGTGTGATGGTTGGTATGGGTCAAAAAGACAGCTATGTAGGTGATGAG Xenopus CGCCACCAG-X-GGTGTCATGGTTGGTATGGGTCAAAAGGACTCCTATGTAGGTGATGAA danio CGTCACCAG---GGTGTCATGGTGGGTATGGGTCAGAAGGACTCATACGTAGGAGATGAA anopheles CGCCACCAG---GGTGTGATGGTCGGCATGGGCCAGAAGGACTCGTACGTCGGCGACGAG drosophila CGTCACCAG---GGTGTGATGGTCGGCATGGGCCAGAAGGACTCGTACGTGGGTGATGAG scerevisiae CGTCATCAA---GGAGTCATGGTCGGTATGGGACAGAAAGACTCGTACGTCGGAGACGAG celegans CGTCATCAA---GGAGTCATGGTCGGTATGGGACAGAAAGACTCGTACGTCGGAGACGAG fugu GCCCAGAGCAAAAGGG---GTATCCTGACCCTGAAATACCCCATTGAGCATGGCATCATC canis GCCCAGAGCAAGAGGG---GCATCCTGACCCTGAAGTACCCCATTGAGCACGGCATCGTC rat GCCCAGAGCAAGCGAG---GTATCCTGACCCTGAAGTACCCCATTGAACACGGCATTATC human GCACAGAGCAAAAGAG---GAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATC mouse GCCCAGAGCAAGAGAG---GGATCCTGACGCTGAAGTATCCGATAGAACACGGCATCATC gallus GCTCAAAGCAAGAGAG---GAATCCTGACCTTGAAATACCCCATAGAACATGGCATCATT Xenopus GCACAGAGCAAGAGAG---GTATTCTTACACTAAAGTATCCAATTGAACATGGTATTATC danio GCTCAGAGCAAGAGGG---GTATCCTCACTCTGAAATATCCCATCGAGCACGGCATCATT anopheles GCCCAGAGCAAACGTG---GTATCCTCACGCTGAAATACCCGATCGAGCACGGTATCGTC drosophila GCGCAGAGCAAGCGTG---GTATCCTCACCCTGAAGTACCCCATTGAGCACGGTATCGTG scerevisiae GCCCAATCCAAGAGAG---GTATCCTTACCCTTAAGTACCCAATTGAGCATGGTATCGTT celegans GCCCAATCCAAGAGAG-X-GTATCCTTACCCTTAAGTACCCAATTGAGCATGGTATCGTT

26 fugu ACCAACTGGGATGACATGGAGAAG---ATCTGGCACCACACCTTCTACAATGAGCTACGT canis ACCAACTGGGACGACATGGAGAAG---ATCTGGCACCACACCTTCTACAACGAGCTGCGC rat ACCAACTGGGACGACATGGAGAAG---ATCTGGCACCACACCTTCTACAATGAGCTGCGT human ACCAACTGGGACGACATGGAAAAG-X-ATCTGGCACCACTCTTTCTACAATGAGCTTCGT mouse ACCAACTGGGACGACATGGAAAAG-X-ATCTGGCACCACTCTTTCTATAACGAGCTTCGT gallus ACCAACTGGGATGACATGGAGAAG-X-ATCTGGCATCACTCCTTCTATAATGAGCTCCGT Xenopus ACTAACTGGGATGATATGGAGAAG---ATTTGGCATCACACCTTCTACAATGAACTGCGT danio ACCAACTGGGACGACATGGAGAAG---ATCTGGCACCACACCTTCTACAATGAGCTCCGT anopheles ACAAACTGGGACGACATGGAGAAA---ATCTGGCACCACACGTTCTACAACGAGCTGCGA drosophila ACCAACTGGGACGATATGGAGAAG---ATCTGGCACCACACCTTCTACAATGAGCTGCGT scerevisiae ACCAACTGGGACGACATGGAAAAA---ATCTGGCATCACACTTTCTACAACGAGCTTCGC celegans ACCAACTGGGACGACATGGAAAAA---ATCTGGCATCACACTTTCTACAACGAGCTTCGC fugu GTGGCCCCTGAGGAACACCCCACCCTGCTGACGGAGGCCCCACTCAACCCCAAAGCCAAC canis GTGGCCCCCGAGGAGCACCCGGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAAC rat GTGGCCCCCGAGGAGCACCCGACCCTGCTCACTGAGGCCCCTTTGAACCCCAAAGCTAAC human GTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAAC mouse GTGGCCCCTGAAGAGCATCCGACACTGCTGACAGAGGCACCACTGAACCCTAAGGCCAAC gallus GTTGCACCTGAGGAGCACCCAACTCTGCTGACTGAAGCACCACTGAATCCCAAAGCCAAT Xenopus GTAGCCCCTGAAGAGCATCCCACCCTGCTTACTGAGGCTCCACTGAACCCTAAAGCTAAC danio GTTGCCCCTGAAGAGCACCCAACTCTGCTGACTGAGGCCCCTCTGAACCCCAAGGCTAAC anopheles GTCGCGCCAGAAGAGCACCCGGTCCTGCTGACGGAGGCCCCGCTCAACCCGAAGGCTAAC drosophila GTGGCACCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCGCTGAACCCCAAGGCCAAC scerevisiae GTTGCCCCAGAAGAGCACCCAGTACTTCTCACTGAAGCCCCACTCAATCCAAAGGCTAAC celegans GTTGCCCCAGAAGAGCACCCAGTACTTCTCACTGAAGCCCCACTCAATCCAAAGGCTAAC

27 fugu AGGGAGAAGATGACCCAG---ATAATGTTTGAGACCTTCAATGTACCCGCCATGTATGTG canis CGTGAGAAGATGACCCAG-X-ATCATGTTCGAGACTTTCAACACCCCAGCCATGTACGTG rat CGGGAGAAGATGACTCAA---ATCATGTTTGAGACCTTCAACGTGCCTGCTATGTATGTG human CGGGAGAAAATGACTCAA-X-ATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTG mouse CGGGAGAAAATGACCCAG-X-ATTATGTTTGAGACCTTCAATGTCCCCGCCATGTATGTG gallus CGAGAGAAAATGACCCAG-X-ATTATGTTTGAGACTTTCAATGTGCCAGCCATGTATGTA Xenopus CGTGAAAAGATGACTCAA---ATAATGTTTGAGACTTTCAACGTCCCAGCTATGTATGTT danio CGTGAGAAGATGACCCAG---ATCATGTTTGAGACCTTCAACGTCCCAGCCATGTATGTG anopheles CGCGAGAAGATGACACAG---ATCATGTTCGAGACGTTCAACACACCGGCAATGTACGTC drosophila CGTGAGAAGATGACCCAG---ATCATGTTCGAGACCTTCAACACACCCGCCATGTATGTG scerevisiae CGTGAAAAGATGACCCAA---ATCATGTTCGAGACCTTCAATACCCCAGCCATGTATGTC celegans CGTGAAAAGATGACCCAA---ATCATGTTCGAGACCTTCAATACCCCAGCCATGTATGTC fugu GCCATTCAGGCCGTACTGTCCCTCTATGCCTCTGGTCGTACCACTG-X-GTATTGTGTTG canis GCCATCCAGGCTGTGCTGTCCCTGTACGCCTCTGGCCGCACCACTG---GCATCGTGATG rat GCTATTCAGGCGGTGCTGTCTCTCTATGCCTCCGGCCGTACCACCG-X-GCATCGTGTTG human GCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTG-X-GCATCGTGCTG mouse GCTATTCAGGCTGTGCTGTCCCTCTATGCCTCTGGACGTACAACTG-X-GTATTGTGCTG gallus GCTATTCAAGCTGTTCTGTCCCTGTATGCTTCTGGGCGTACTACAG-X-GGATTGTGCTT Xenopus GCAATCCAGGCAGTGCTTTCTCTATACGCCTCTGGCCGTACAACTG-X-GGATTGTGCTC danio GCCATTCAGGCTGTGCTGTCCCTCTACGCTTCTGGCCGTACCACTG---GTATCGTGCTG anopheles GCCATCCAGGCCGTGCTGTCGCTGTACGCCTCCGGTCGCACCACCG---GTATCGTGCTG drosophila GCCATCCAGGCTGTGCTCTCGCTGTACGCCTCCGGTCGTACCACCG---GTATCGTTCTG scerevisiae GCCATCCAAGCTGTCCTCTCCCTCTACGCTTCCGGACGTACCACCG---GAATCGTCCTC celegans GCCATCCAAGCTGTCCTCTCCCTCTACGCTTCCGGACGTACCACCG---GAATCGTCCTC

28 Pan troglodytes average nucleotide divergence of just 1.2%


Scaricare ppt "Teorie sullorigine degli introni e dei geni Francesco Piva Istituto di Biologia e Genetica."

Presentazioni simili


Annunci Google