La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Il materiale riportato in queste diapositive è di esclusiva proprietà del Prof. Liborio Stuppia. La pubblicazione delle diapositive su questo sito è intesa.

Presentazioni simili


Presentazione sul tema: "Il materiale riportato in queste diapositive è di esclusiva proprietà del Prof. Liborio Stuppia. La pubblicazione delle diapositive su questo sito è intesa."— Transcript della presentazione:

1 Il materiale riportato in queste diapositive è di esclusiva proprietà del Prof. Liborio Stuppia. La pubblicazione delle diapositive su questo sito è intesa unicamente a scopo di consultazione da parte degli studenti dei corsi di Genetica Medica della Facoltà di Psicologia della Università “G. d’Annunzio”. E’ proibita la riproduzione e la diffusione anche parziale del materiale contenuto in queste diapositive. AVVISO

2 Dal genotipo al fenotipo

3 Genotipo e Fenotipo Genotipo: – Costituzione genetica di ogni singolo individuo Fenotipo: – L’insieme delle caratteristiche fisiche, biochimiche e mentali di un individuo

4 Genotipo Fenotipo Relazione tra genotipo e fenotipo

5 Rapporto tra genotipo e fenotipo F = G + A – (F= Fenotipo; G= Genotipo; A= ambiente=) G + A = 1 – L’apporto di G ed A a F è variabile. Per A = 0 avremo che F = G, ossia il fenotipo sarà integralmente prodotto dal genotipo. Per G = 0 il fenotipo sarà totalmente prodotto dall’ambiente.

6 Esempi di rapporto genotipo-fenotipo F=G F=A F=G+A

7 Fenotipo ed eredità Un fenotipo in un cui F=G (A=0) sarà ereditato in base alle leggi di Mendel Un fenotipo in cui F= G+A sarà ereditato in modo complesso Un fenotipo in cui F=A (G=0) non sarà ereditato

8 Genotipo (diverso in tutti gli individui) Ambiente (diverso o uguale tra gli individui) Fenotipo (in parte uguale, in parte diverso tra gli individui)

9 Diverso genotipo non vuol dire possedere geni diversi, ma possedere diverse varianti dello stesso gene

10

11 Variabilità genetica: - 85% interindividuale - 10% intercontinentale - 5% interrazziale

12 Le due funzioni del genotipo Manifestarsi nell’individuo attraverso il fenotipo Trasmettersi identico nelle nuove cellule dell’individuo e nella sua prole

13 Cromosomi e geni Sui cromosomi di ogni individuo sono presenti i geni, ognuno in una specifica posizione (locus) Ogni gene determina direttamente o indirettamente uno o più fenotipi

14 I geni come unità funzionali del DNA Ogni gene è che un tratto specifico di DNA capace di produrre RNAm All’interno di ogni singolo gene si trovano strutture particolari come il promotore, gli esoni e gli introni

15 Il DNA umano: non solo geni Caratteristiche delle sequenze di DNA presenti nel genoma umano: – Lunghezza: circa 3 miliardi di nucleotidi – Percentuale del genoma che viene tradotto il proteine: 1,5% – Percentuale del genoma che è trascritto ma non tradotto: 25%

16 Dal DNA alle proteine Il DNA presente nel nucleo delle cellule contiene l’informazione genetica per produrre le proteine Al momento necessario, viene prodotto RNA messaggero, che ha il compito di trasportare l’informazione genetica dal nucleo al citoplasma L’RNAm provvederà a produrre le proteine, che determineranno specifici fenotipi

17 Struttura e funzione di un gene

18 La sintesi delle proteine

19 Il ruolo delle proteine Le proteine prodotte dai geni agiscono in un individuo determinando, insieme all’ambiente: – L’aspetto fisico – Il metabolismo – Le capacità cognitive – La capacità di reagire a stimoli esterni Tale ruolo è esercitato attraverso 3 funzioni: – Strutturale – Ormonale – Enzimatica

20 Caratteri qualitativi

21 Caratteri quantitativi

22 A, G, C, T L’universalità del codice genetico

23 Lo stratagemma del codice genetico AGTGCTGATCGTAGCTAGCTAGCTAGCTAG AGT-GCT-GAT-CGT-AGC-TAG-CTA-GCT-AGC-TAG aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8 aa9 aa10 Proteina X

24 Il codice genetico

25 Il mantenimento della informazione genetica Le cellule di un organismo si moltiplicano sotto l’influenza di diversi stimoli (durante la crescita, a seguito di lesioni, ecc.) Ad ogni divisione cellulare corrisponde una duplicazione del DNA al termine della quale le cellule figlie devono possedere lo stesso patrimonio genetico della cellula madre La capacità del DNA di trasmettere la informazione genetica è legata alla sua proprietà di duplicarsi e di distribuirsi in maniera identica nelle cellule figlie

26 Come fa il DNA a restare sempre uguale nelle divisioni cellulari? Il DNA si duplica in maniera “semiconservativa”, ossia ogni cellula figlia conterrà una catena ereditata dalla cellula madre ed una di nuova formazione In tale modo, nel corso delle divisione cellulare, il DNA si trasmette sempre uguale a se stesso

27 Il ciclo cellulare e la divisione cellulare

28 Le fasi della divisione mitotica


Scaricare ppt "Il materiale riportato in queste diapositive è di esclusiva proprietà del Prof. Liborio Stuppia. La pubblicazione delle diapositive su questo sito è intesa."

Presentazioni simili


Annunci Google