La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Cromosomopatie Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute.

Presentazioni simili


Presentazione sul tema: "Cromosomopatie Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute."— Transcript della presentazione:

1 Cromosomopatie Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine, Napoli

2 Consulenza genetica La consulenza genetica è comunicazione informata ed appropriata Per essere informata deve partire dall’individuazione di un difetto genetico in un paziente e dal calcolo del rischio per gli altri componenti della famiglia Per poter essere appropriata deve saper stabilire un rapporto di fiducia e di confidenza senza essere direttiva, cioè non deve indirizzare la famiglia verso un unico obiettivo, ma lasciare libertà di valutazione e di scelta La consulenza genetica può riguardare: 1.la diagnosi di una malattia genetica clinicamente manifesta 2.il rischio riproduttivo di una coppia in epoca preconcezionale 3.la diagnosi prenatale 4.la predizione di una malattia genetica futura 5.la suscettibilità genetica

3 Consulenza genetica distinguiamo due grandi categorie di patologie genetiche: 1)monoalleliche, dovute alla mutazione di una sola copia del DNA 2)bialleliche, dovute a mutazioni di entrambe le copie del DNA patologie a penetranza completa (in genere disordini mendeliani) a penetranza incompleta, o addirittura “circoscritta”. La consulenza genetica cerca di stabilire quali membri della famiglia sono interessati ed eventualmente quali possono essere portatori, e quindi calcolare la probabilità di ogni altra persona nella famiglia (anche non ancora nata) di essere un portatore o di ereditare la malattia

4 rischio riproduttivo generale per una coppia per cui l’anamnesi personale e familiare abbiano escluso un incremento del rischio rispetto alla popolazione è 3-5% in caso di difetti congeniti rilevabili alla nascita (anomalie cromosomiche 0.65%) 8-10% rilevabili entro i 10 anni di età

5 Durante la mitosi: centromero ciascun cromosoma si duplica producendo due copie identiche: i cromatidi fratelli. I cromatidi restano associati mediante il centromero. le copie si separano. ciascuna copia migra in una cellula cromatidi fratelli

6 LE FASI DELLA MITOSI Interfase Profase Metafase Anafase Telofase

7 meiosi La meiosi è il processo che porta alla formazione dei gameti I gameti sono cellule aploidi: hanno la metà dei cromosomi delle cellule diploidi 23 è il numero di cromosomi dei gameti 46 è il numero di cromosomi di ogni altra cellula umana La meiosi consiste in due divisioni cellulari meiosi I (riduzionale) e meiosi II (equazionale) che producono quattro cellule aploidi

8 meiosi Meiosi I Replicazione del DNA 46 cromosomi 92 Cromatidi / 92 dsDNA Divisione riduzionale separazione delle coppie di cromosomi 23 cromosomi 46 cromatidi / 46 dsDNA Meiosi II Separazione dei cromatidi 23 cromosomi 23 cromatidi / 23 dsDNA

9 1.Profase I: ciascun cromosoma si duplica e le due parti restano strettamente associate. Questi sono chiamati cromatidi fratelli. Il crossing-over avviene in questa fase 2.Metafase I: I cromosomi omologhi si allineano al piano equatoriale 3.Anafase I: Le coppie omologhe si separano e i cromatidi fratelli restano uniti 4.Telofase I: le due cellule figlie contengono solo un cromosoma di ciascuna coppia Meiosi I 46 cromosomi 92 Cromatidi / 92 dsDNA

10 meiosi I, profase I Leptotene –i cromosomi si rendono visibili Zygotene –le coppie di cromosomi omologhi formano le tetradi Pachitene –crossing over Diplotene –i cromosomi iniziano a separarsi ma sono tenuti insieme dai chiasmi Diacinesi –ulteriore accorciamento dei cromosomi omologhi

11 1.Profase II: il DNA delle due cellule figlie non si replica. 2.Metafase II: i cromosomi si allineano al piano equatoriale 3.Anafase II: I centromeri si dividono e i cromatidi fratelli migrano separatamente a ciascun polo 4.Telofase II: la seconda divisione cellulare è completa. Quattro cellule figlie aploidi (23) sono ottenute Meiosi II 23 cromosomi 23 cromatidi / 23 dsDNA

12 Oogonium Primary oocyte Secondary oocyte Polar Body I Fertilized Ovum Polar Body II Gametogenesi Spermatogonium Primary spermatocyte Secondary spermatocytes 4 spermatids 4 spermatozoa

13 Oogonium Primary oocyte Secondary oocyte Polar Body I Fertilized Ovum Polar Body II maschio spermatogonio spermatocita primario spermatocita Secondario 4 spermatidi 4 spermatozoi Mitosi alla pubertà Per tutta la vita Meiosi in 64gg

14 Mitosis Periodo fetale alla nascita o prima dopo la nascita dopo la pubertà Alla fertilizzazione Meiosi in progress Si arresta al diplotene della meiosi I Meiosi I completa Si arresta alla metafase II Meiosi II completa Oogonio oocita primario oocita secondario e corpo polare I Fertilized Ovum & Polar body II femmina

15 Cromosomi (corpi colorati) durante il ciclo cellulare i cromosomi replicano e si formano due cromatidi fratelli tenuti insieme dal centromero braccio corto = p (petit) braccio lungo = q (lettera successiva)

16

17 citogenetica di routine da linfociti sono rappresentativi di ciascun altra cellula del corpo

18

19 citogenetica prenatale da amniociti da villi coriali dovrebbero essere rappresentativi delle cellule del feto difficili da ottenere

20

21 Cromatina (DNA+proteine) Eucromatina - meno condensata contiene il DNA codificante Eterocromatina - più condensata non contiene DNA codificante, ma solo DNA non codificante Telomeri - cappucci all’estremità dei cromosomi che comprendono ripetizioni multiple della sequenza TTAGGG Centromeri - regioni specializzate di DNA che forniscono il sito di ancoraggio del fuso mitotico

22 Eucromatina ed eterocromatina

23 TecnicaProceduraBanding pattern bandeggio G Proteolisi limitata seguita dalla colorazione Giemsa Le bande scure sono ricche in AT Le bande chiare sono ricche in GC bandeggio R denaturazione al calore seguita dalla colrazione con Giemsa Le bande scure sono ricche in GC Le bande chiare sono ricche in AT bandeggio Q digestione enzimatica e colorazione con un colorante fluorescente, cioè la Quinacrina Le bande scure sono ricche in AT Le bande chiare sono ricche in GC bandeggio C denaturazione con idrossido di bario e poi colorazione con Giemsa Le bande scure sono ricche in eterocromatina costitutiva

24 Colorazione dei cromosomi con coloranti specifici per regioni ricche in AT o in GC

25

26 metacentrici, se il centromero è centrale 1, 2, 3, 16, 17, 18, 19 submetacentrici, se il centromero non è centrale e non è vicino ad un’estremità 4, 5, 6, 7, 8, 9, 10, 11, 12, 20, X, Y acrocentrici, se il centromero è vicino ad un’estremità 13, 14, 15, 21, 22

27

28 CCDS IDs per chromosome ChromosomeCount 12,513 21,548 31, ,028 61,236 71, , , , , X967 Y53 XY23

29 Eteromorfismi citogenetici Variazione pericentromerica del crom. 9 9qh+ Inversione 9 inv Variazione + inversione

30 Ereditarietà della variazione pericentromerica del cromosoma 1

31 Le alterazioni cromosomiche sono più frequenti al crescere dell’età materna, mentre le mutazioni puntiformi sono legate al numero di divisioni cellulari che avvengono circa ogni 15 gg nella linea germinale maschile

32 tritest interpretazione dei risultati anomalia fetale AFP Alfa-feto proteina Beta hCGuE estriolo non coniugato NTD =difetti del tubo neurale * Normale Trisomia 21 Trisomia 18 * NTD: anencefalia, spina bifida and encefalocele

33 Translucenza nucale free-  HCG PAPP-A Trisomia Trisomia 13, S. di Turner+++++/-- Triploidia materna +/ Triploidia paterna /- Il duotest (double screen) include la valutazione del PAPP-A (Pregnancy Associated Plasma Protein A) e la frazione libera della gonadotropina corionica (free-betaHCG). Viene effettuato tra la 10ma e la 13ma settimana di gravidanza dal siero della gestante

34 Patologia fetaleSensibilità NTD - AFP solo75-80% spina bifida 95% anencefalia Trisomia 21 - Tritest70% Down sindrome Trisomia 18 - Tritest80% sindrome di Edward

35 Anomalie ecografiche maggiori

36 ecografia “segni minori”

37 Frequenza di anomalie cromosomiche negli aborti spontanei (39.8%-40.9%) trisomie autosomiche 49-52% Turner (45, X) 15-19% triploidia (69) 15-16% tetraploidia (92) 5-6% altre anomalie 6-14%

38 Il 70% delle gravidanze non giunge a termine trisomia 21 Down

39 + Meiosis 1 Meiosis 2 or + SEA Meiosis 1 error Meiosis 1 error Meiosis or 3 other combinations Meiosis 1 Meiosis 2 error Meiosis 2 error or other combinations Meiosis 1 Meiosis Mitotic error Mitotic error

40 origine dell’extra cromosoma 21 sea3109 Data from the Antonarakis and Hassold laboratories MM168% MIT5.5% PM12.6% MM219.8% PM24.1%

41 anomalie cromosomiche riscontrate Numero free T21 t14;21 t13;21 t15;21 t21;21 t21;22 altre t mosaicism Anomalia q p D21S17 ETS2 MX1 DSCR HC21

42 fenotipo Livello di espressione Ipotesi sulla variabilità del fenotipo di 6 individui diversi in caso di trisomia 21 in presenza di varianti alleliche

43 u Neurologici : –Ritardo mentale 100% –Alzheimer dopo i 35anni100% u Ipotonia muscolare 100% u Bassa statura 70% u Testa : –Brachicefalia 75% –Epicanto 60% –brushfield spots iride 55% –lingua protrudente 45% –orecchie displastiche50% trisomia 21 Down casi in Italia

44 u Arti corti, mani larghe 65% u Mignolo corto60% u Solco palmare trasverso60% u Cuore –Difetti cardiaci congeniti40% –Canale atrioventricolare 16% u Anomali gastrointestinali –Atresia/stenosi duodenale250x –ano imperforato 50x –Hirschsprung 300x u Sangue: –Leucemia acuta megacariocitica 300x –Leucemia (ALL e AML) 10-20x trisomia 21 Down

45 trisomia 18 Edwards (1/6.500 nati)(1/6.500 nati) 90% dei casi nondisgiunzione materna M/F = 1/4 Giunge a termine solo il 2.5% dei concepimenti Di questi il 33% muore nel primo mese, il 50% entro 2 mesi Oltre 100 anomalie Peso sotto la norma, difficoltà suzione Ipotonia Idrocefalo, epilessia Malformazioni cardiache sinclinodattilia, unghie poco sviluppate piedi a calcagno prominente Gambe incrociate

46 trisomia 13 Patau (1/ nati)(1/ nati) 90% dei casi nondisgiunzione materna Giunge a termine solo il 2.5% dei concepimenti Di questi il 33% muore nel primo mese, il 50% entro 2 mesi Peso sotto la norma, difficoltà suzione Oloprosencefalia, microcefalia Cecità e sordità Occhi che possono fondersi Labiopalatoschisi 80% epilessia Malformazioni cardiache sinclinodattilia piedi a calcagno prominente

47 XX o XY Il sesso maschile è determinato dalla presenza del cromosoma Y Si sono evoluti meccanismi per compensare la differenza di dosaggio genico del cromosoma X, presente in 2 copie nelle femmine e in 1 copia nei maschi

48 1.il cromosoma X raddoppia l’espressione di tutti i geni contenuti, cioè si produce 2 volte più RNA 2.nelle femmine uno dei due cromosomi X è inattivato casualmente in ciascuna cellula allo stadio di blastocisti 2 cromosomi X nelle donne, 1 solo negli uomini?

49 1.Nel Klinefelter (XXY) uno dei due cromosomi X è inattivato casualmente in ciascuna cellula allo stadio di blastocisti 2.Quindi il dosaggio sarebbe mantenuto Il Klinefelter?

50 Sindrome di Klinefelter (47,XXY) 1:900-1:600 maschi Il 50% delle gravidanze giunge a termine Fenotipo maschile Caratteristiche principali: Statura alta –Ipogonadismo, bassi livelli di testosterone, mancata produzione di spermatozoi (azoospermia) e quindi sterilità –Ginecomastia –Sia l’intelligenza sia l’attesa di vita sono quasi normali

51 Altre forme citogenetiche Ma ci sono anche Klinefeler 48,XXYY and 48,XXXY in 1 caso su 17,000 e 1 su 50,000 mnati maschi 49,XXXXY in 1 caso su 85, ,000 Ci sono maschi 46,XX in cui avviene una traslocazione di parte di cromosoma Y sul cromosoma X che include la sex determining region (SRY) mosaici

52 Le regioni PAR presenti sui cromosomi sessuali contengono geni che non sono inattivati, perché il doppio dosaggio è assicurato comunque PAR1 ha 24 geni, PAR2 ha solo 4 geni

53 Il gene SHOX Short stature HOmeoboX-containing Mutazioni o delezioni del gene SHOX nella regione PAR1 causa ritardo di crescita e bassa statura. La bassa statura di donne con sindrome di Turner Syndrome (X0) è il risultato di una sola copia di SHOX (ma anche il quarto metacarpo corto) La maggiore statura nel Klinefelter (XXY) e nella tripla X (XXX) potrebbe essere il risultato di 3 copie di SHOX

54 Livello di espressione variabilità dei geni del cromosoma X delle regioni PAR, quindi non inattivati 3 copie nel Klinefelter, ma anche nella tripla X Mario Rossi Luca Bianchi Pio Verdi Giulio Rosa Lucio Viola Gianni Neri

55 A complicare le cose… circa il 15 % dei geni umani presenti sull’X sfugge all’inattivazione, mentre nel topo questa è un’evenienza rara (solo 6 geni in tutto) alcuni sono espressi al % altri al 10% questo fenomeno è quindi incompleto e le donne hanno una elevata eterogeneità nell’espressione di geni dell’X

56 Manifestazione clinica: SI Livello di espressione ipotesi sulla variabilità di ogni singola manifestazione clinica di Klinefelter in presenza di varianti in geni del cromosoma X non inattivati Mario Rossi Luca Bianchi Pio Verdi Giulio Rosa Lucio Viola Gianni Neri Manifestazione clinica: NO

57 Quanti Klinefelter? Prevalenza di XXYs è cresciuta da 1.09 a 1.72 per 1000 maschi nati (P=0.023) Questo incremento non è dovuto all’aumento dell’età materna Sono nati maschi in Italia e maschi in Campania nel 2007 max nuovi Klinefelter ogni anno in Italia (32-52 in Campania) XXY è la sola trisomia nota in cui circa il 50% dei casi è causato da una non disgiunzione alla prima divisione meiotica paterna

58 Trisomia X (47,XXX) 1:1.200 Il 70% delle gravidanze giunge a termine Errore nella disgiunzione materna e correla con l’età materna Caratteristiche principali: –Statura alta –Fertilità normale, irregolarità ciclo –Sia l’intelligenza sia l’attesa di vita sono normali

59 Maschio (47,XYY) 1:1.000 maschi Fenotipo maschile Caratteristiche principali: –Statura alta –Fertilità normale –Non vi è correlazione con l’età paterna –Sia l’intelligenza sia l’attesa di vita sono perfettamente normali

60 Monosomia X (45,X0) Turner Prende il nome dall’endocrinologo Henry Turner che la descrisse nel 1938 La sindrome di Turner (TS) definisce un complesso fenotipo umano femminile, dovuto a completa o parziale assenza del secondo cromosoma sessuale Dipende da un errore nella spermatogenesi nell’80% dei casi e non correla con l’età dei genitori Un precedente figlio con TS non aumenta il rischio riproduttivo previsto per una coppia di pari età

61 Monosomia X (45,X0) Turner È l’unica monosomia compatibile con la vita, ma il 98% di tutti i feti monosomici TS va incontro ad aborto spontaneo L’incidenza negli aborti è circa il 7-10%, mentre alla nascita è 1/2500 femmine. Non è chiaro perché il cariotipo 45, X0 sia letale in utero ed invece compatibile con la sopravvivenza postnatale La vera monosomia del cromosoma X è responsabile del 45% dei casi TS; gli altri hanno mosaicismo (45, X0/46, XX) e/o un anormale cromosoma X o Y Un basso livello di mosaicismo somatico Turner, inferiore al 2%, è di normale riscontro nella popolazione

62 Monosomia X (45,X0) Turner “la menopausa precede il menarca” Le ovaie sono allungate e formate da tessuto stromale privo di follicoli:gli oociti sono spesso andati in apoptosi prima dei 2 anni di vita L’insufficienza ovarica prepuberale porta ad amenorrea primaria, sterilità e carenza di estrogeni In meno del 10% dei casi, la pubertà può verificarsi e sono possibili gravidanze con un aumentato rischio di perdita fetale Anche in rapporto all’eterogeneità del genotipo, il fenotipo si manifesta in modo molto variabile

63 Monosomia X (45,X0) Turner 1:2.500 patologie dell’orecchio medio (otite media ricorrente) Linfedema con rigonfiamento delle mani e dei piedi pterigio del collo (presenza di pliche cutanee con aspetto di sfinge) il quarto metacarpo (anulare) più corto una mandibola più piccola (micrognazia) torace largo con aumento degli spazi intercostali l’attaccatura bassa delle orecchie e dei capelli Si possono anche riscontrare cardiopatia sinistra (valvola aortica dicuspide, coartazione aortica), ipertensione e anomalie renali

64 feto con anomalia cromosomica (mosaicismo) trisomie a mosaico 8, 9, 13, 18, 21 crescita in coltura di cellule materne mosaicismo vero (livello III) pseudomosaicismo (livelli II e I)

65 triploidia Frequenza alla nascita = 1/ Frequenza negli aborti = 1/14 Cariotipo 69,XXY 57% Cariotipo 69,XXX 40% Cariotipo 69,XYY 3%

66

67

68 Tipo I, corredo sovrannumerario paterno Feto microcefalico o normale Placenta ingrossata Tipo II, corredo sovrannumerario materno Ritardo di crescita Feto con macrocefalia relativa Placenta poco sviluppata Nati vivi Basso peso Asimmetria cranio-facciale e difetti di ossificazione del cranio Microftalmia, ipertelorismo, micrognazia Sindattilia cutanea, piedi torti Anomalie genitali, ipoplasia delle surrenali Cardiopatie

69 47,XXY/46,XY Mosaicismo, quando il cambiamento avviene dopo che si è formato lo zigote

70 Un precedente figlio con anomalie cromosomiche Aumenta il rischio in caso di: tutte le trisomie non mosaico riarrangiamenti strutturali marker cromosomi

71 Un precedente figlio con anomalie cromosomiche NON aumenta il rischio in caso di: 47, XYY triploidia, tetraploidia sindrome di Turner

72 Valutazione del rischio riproduttivo nel periodo preconcezionale momento ottimale (ma oltre la metà delle gestazioni insorge inaspettatamente) raccolta dei dati (visita, abitudini, terapie, accertamenti lab) SCOPO: identificazione dei portatori sani di malattie genetiche –portatori che hanno un rischio riproduttivo a prescindere dal partner –portatori in cui il rischio si manifesta solo nel caso di unione con un partner portatore

73 portatori che hanno un rischio riproduttivo a prescindere dal partner donne con mutazioni legate all’X (esempio: Distrofia muscolare di Duchenne)

74 portatori che hanno un rischio riproduttivo a prescindere dal partner portatori di una traslocazione cromosomica bilanciata –scambio di materiale genetico tra cromosomi non omologhi –non vi è modificazione della dose genica –frequenza 1/520 nati –fenotipicamente normale reciproca

75 coppia con familiarità per anomalie cromosomiche è indicazione all’esecuzione di un cariotipo fetale e l’estensione dell’indagine ai parenti traslocazioni X-autosoma –maschi sterili, femmine inattivano la X normale traslocazioni robertsoniane –non 21 60% cariotipo bilanciato –21 15% rischio di Down, se è eterozigote la madre 1% se è eterozigote il padre inversioni –pericentriche varianti dell’1, 9, 16 e Y, in altri casi il rischio è 5-10% –paracentriche, rischi inferiore allo 0.5%

76 Traslocazioni bilanciate (meiosi e fertilizzazione) Traslocazione bilanciata Normale Traslocazione Trisomia Segregazione alternata Segregazione adiacente 1 Segregazione adiacente 2

77 influenze sugli effetti della traslocazione Cromosomi coinvolti e lunghezza del tratto traslocato (perché vi è una forte selezione pre e postzigotica): maggiori sono le dimensioni cromosomiche minore è la possibilità di una gravidanza a termine Sesso del genitore donna>uomo (gli spermatozoi hanno il 7.5% di difetti contro l’1% degli oociti, ma sono selezionati) Il rischio aumenta se il difetto è stato accertato a partire da un figlio precedente con cariotipo sbilanciato

78 rischio alla nascita di figli con cariotipo sbilanciato Se non vi sono stati casi in famiglia e la madre è eterozigote per una traslocazione reciproca il rischio è il 7% Se non vi sono stati casi in famiglia e il padre è eterozigote per una traslocazione reciproca il rischio è il 3% Se vi sono stati casi di traslocazioni sbilanciate in famiglia e la madre è eterozigote il rischio è il 14% Se vi sono stati casi di traslocazioni sbilanciate in famiglia e il padre è eterozigote il rischio è l’8%

79 donna eterozigote per una traslocazione bilanciata X-autosoma

80

81 Traslocazioni reciproca Robertsoniana

82 Rischio alla nascita di figli con cariotipo sbilanciato da genitori con traslocazione robertsoniana t(13;14) M=F 1% t(14;21) F 15% M 2% t(21;22) F 10% M 5% t(21;21) M=F 100%

83 portatori che hanno un rischio riproduttivo a prescindere dal partner mutazioni dominanti ad esordio tardivo (corea di Huntington, atassie spinocerebellari) mutazioni dominanti a penetranza incompleta

84 portatori in cui il rischio si manifesta solo nel caso di unione con un altro portatore mutazioni autosomiche recessive –con familiarità (coppia già a rischio) –senza familiarità (valutare la consanguineità)

85 ogni individuo è portatore sano di almeno 8 malattie genetiche recessive, di cui 3 letali fratelli, genitori-figli fratellastri, zii-nipoti cugini diretti (0.5%) secondi cugini 1/4 omozigosi 1/8 omozigosi 1/16 omozigosi 1/64 omozigosi i difetti congeniti hanno un rischio empirico raddoppiato in caso di cugini primi non è utile l’esame cromosomico

86

87 feto con anomalia cromosomica (mosaicismo) trisomie a mosaico 8, 9, 13, 18, 21 crescita in coltura di cellule materne mosaicismo vero (livello III) pseudomosaicismo (livelli II e I)

88 Whitehead Institute, Center for Genome Research, Cambridge, MA

89

90 La grandezza totale del genoma umano aploide è di basi di cui sono di eucromatina

91 UCSC Genome Browser Screenshot from University of California at Santa Cruz

92 disordine genomico submicroscopico Il disordine genomico submicroscopico è una patologia causata da acquisizione perdita alterazione di uno o più geni contigui le cui variazioni di dosaggio possono produrre effetti fenotipici La base molecolare è rappresentata da riarrangiamenti genomici, quali duplicazioni, delezioni, inversioni, senza grosse alterazioni del cariotipo (<5Mb)

93 In caso di delezioni del cromosoma X nei maschi si osserva direttamente in fenotipo come sindrome da geni contigui In caso di delezioni autosomiche in eterozigosi, molto spesso il dosaggio dimezzato non è causa di malattia. Quando si osserva una sindrome da delezione, è risolutivo trovare la stessa sindrome causata da una mutazione puntiforme in uno solo dei geni. Se questa non si trova, la sindrome esiste solo come somma di più difetti.

94 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA

95 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACTATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCG ACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTA GCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAG CTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCC GACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCG ACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACA CACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCT CGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTC CTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACA GATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCT CGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATA TATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAG ATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACAC CGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAG CTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTG AAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGA CCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGA 1 2 Copy Number Variation 10% of the human genome could vary in copy number

96 principali sindromi da delezione

97 FISH

98

99 Sonde FISH centromero subtelomero intero cromosoma locus

100 PAINTING

101

102

103 Sindrome di DiGeorge

104 DiGeorge/velocardiofacciale La sindrome di DiGeorge del22q11.2 è la più frequente sindrome da microdelezione, con un incidenza di 1 su 4000—5000 nati La delezione comprende 3Mb ed almeno 30 geni

105 Migrating neural crest cells make a contribution to the embryonic structures affected in DiGeorge syndrome. The cartoon represents a human embryo at 4–6 weeks gestation. The migration of neural crest cells from the hindbrain to the branchial arch/pharyngeal pouch system and cardiac outflow tract is indicated by the arrows. Examples of malformations associated with perturbation of this process are listed and these overlap substantially with those seen in 22q11DS AAA, arch arteries; PDA, persistent ductus arteriosus; IAA, interrupted aortic arch.

106 DiGeorge È caratterizzata da –Anomalie cardiache –T-cell deficit –palatoschisi –anomalie facciali –Ipocalcemia Mutazioni puntiformi del gene TBX1 possono portare a questi 5 tratti fenotipici, ma non alle difficoltà nell’apprendimento che è invece frequente nella sindrome da delezione

107 Williams-Beuren prevalenza alla nascita 1/ /20.000, ma può non essere diagnosticata

108 Williams una delezione tipica

109 Williams genetica delezione “de novo” trasmissione autosomica dominante delezione di 1.6MB da 21 geni contigui in eterozigosi a 7q11.23 –gene dell’elastina –LIM kinase 1 (LIMK1) –CLIP-115 che lega i microtubuli –Fattori di trascrizione GTF2I e GTF2IRD1 –effetto posizionale su altri geni circostanti la delezione

110 Williams FISH delezione 7q11.23 rilevabile mediante FISH ma non cariotipo rilevabile mediante FISH ma non cariotipo

111 Williams comportamento lieve o medio ritardo mentale (IQ tra 41 e 80) scarsa capacità di concentrazione ritardo nell’apprendimento del linguaggio e poi esagerata loquacità personalità amichevole e affettuosa danno facilmente confidenza anche a sconosciuti ansietà, spesso preoccupati per il benessere altrui ipersensibilità ai suoni memoria visiva e uditiva spesso fuori dal comune ricordano persone, luoghi e motivi musicali predisposizione ad imparare le lingue e la musica

112 Williams aspetto e segni Faccia da elfo Occhi blu (77%) con pattern stellato dell’iride (74%) ma questo vale per i nordeuropei, strabismo (40%) Naso con la punta bulbosa bocca larga e guance piene microdontia e micrognazia Statura 10 cm in meno del normale ipercalcemia stenosi periferica delle arterie polmonari stenosi aortica sopravalvolare

113 Williams foto

114

115 Wolf-Hirschhorn genetica delezione “de novo” di circa 4MB le delezioni sono più frequenti nella linea germinale maschile trasmissione autosomica dominante Regione critica di 165 kb di molti geni contigui in eterozigosi a 4p16.3

116 Wolf-Hirschhorn delezione a 4p16.3

117 Wolf-Hirschhorn Scarso accrescimento Ritardo mentale, ipotonia Labbro leporino Conformazione ad elmo di guerriero greco

118 Sindrome 5p- (cri du chat) 1: nati Pianto acuto e flebile Caratteristiche principali: –Ritardo di crescita –Microcefalia ed ipertelorismo –Ipotonia, diastasi dei retti –Deficit intellettivo e del linguaggio

119 Imprinting

120 Nelle cellule germinali primordiali l’imprinting viene cancellato del tutto e il DNA è demetilato Successivamente nella linea germinale maschile si determina un pattern di imprinting che in alcuni loci è complementare a quello della linea germinale femminile I cromosomi su cui avviene l’imprinting (7, 11, 15) manterranno questo pattern e lo riprodurranno ad ogni mitosi Si potranno sempre distinguere l’espressione genica del cromosoma materno e paterno

121 Disomia uniparentale Due copie dello stesso cromosoma sono ereditate dallo stesso genitore Spesso questo avviene attraverso un fenomeno transitorio di trisomia, seguito dalla perdita del cromosoma singolo e mantenimento del cromosoma doppio

122 Angelman 70% dei casi delezione della regione cromosomica 15q11-q13, che è soggetta al fenomeno dell'imprinting del cromosoma paterno Il gene materno (l'unico espresso) può essere alterato con 4 meccanismi noti: –delezione –disomia uniparentale paterna –difetti nell'imprinting –mutazioni a carico del gene UBE3A (ubiquitin ligasi) La diagnosi è clinica e il difetto genetico non si identifica nel 20% dei casi

123

124 "happy puppet syndrome" si può identificare in Cucciolo (Dopey) "addormentato", il più giovane dei nani che non ha mai imparato a parlare ritardo mentale con assenza del linguaggio, difficoltà nell'equilibrio, eccessivo buon umore Angelman

125 L'incidenza è 1/ nati crisi epilettiche e comunque alterazioni dell'EEG e microcefalia relativa Angelman

126 Prader-Willi iperfagia>obesità eccessiva assunzione di liquidi reazioni abnormi ai sedativi acromicria, criptorchidismo insensibilità al dolore, lesioni cutanee sbalzi di umore

127 Prader-Willi 1/15.000

128 Nomenclatura delle delezioni Le delezioni sono designate con la sigla del che segue i numeri dei nucleotidi a monte e a valle della delezione separatida un segno _ –82_83del (o 82_83delTG) indica una delezione di TG nella sequenza ACTTTGTGCC (dove A è il nucleotide 76) che diventa ACTTTGCC

129 Malattie degenerative progressive Variazione dello spessore delle miofibrille con forti cambiamenti nella istologia del muscolo indebolimento e degenerazione del tessuto muscolare in fibroso e adiposo aree di necrosi con processi infiammatori Cosa sono le distrofie muscolari?

130 Duchenne Becker cingoli facio- scapolo- omerale distale oculo- faringea Emery- Dreifuss

131 Distrofia muscolare Duchenne/Becker DMD Duchenne - 1/3,500 maschi Insorgenza -- Infanzia - tra 2 e 6 anni Sintomi – Debolezza generalizzata e danno muscolare prima agli arti e al tronco, polpacci ingrossati Progressione – Lenta ma inesorabile. Colpisce tutti i muscoli volontari. Sopravvivenza fino a anni BMD Becker - 1/10,000 maschi Insorgenza – Adolescenza o dopo Sintomi – Identici alla DMD ma più attenuati. Vi è coinvolgimento cardiaco significativo Progressione – Più lenta e più variabile della distrofia di Duchenne con buona aspettativa di vita

132 Le delezioni intrageniche del gene della distrofina mandano fuori cornice la lettura delle triplette quando gli esoni cancellati contenevano un numero di nucleotidi che non è multiplo esatto di tre (1,2,4,5,7,8,10,11 ecc). Questo causa la distrofia di Duchenne.

133

134 Le delezioni intrageniche che non alterano la cornice di lettura portano alla distrofia muscolare di Becker o ad un apparente buona salute. Forniscono informazioni per preparare delle microdistrofine per la terapia genica

135 Nomenclatura delle delezioni Le delezioni sono designate con la sigla del che segue i numeri dei nucleotidi a monte e a valle della delezione separatida un segno _ –82_83del (o 82_83delTG) indica una delezione di TG nella sequenza ACTTTGTGCC (dove A è il nucleotide 76) che diventa ACTTTGCC

136 MLPA probes

137 Hybridization 1.The MLPA probemix is added to denatured genomic DNA 2.The two parts of each probe hybridise to adjacent target sequences

138 ligation 3. Probes are ligated by a thermostable ligase

139 PCR amplification 4.A universal primer pair is used to amplify all ligated probes The PCR product of each probe has a unique length ( bp)

140 separation and quantification by capillary electrophoresis Each peak is the amplification product of a specific probe. Samples are compared to a control sample. A difference in relative peak height or peak area indicates a copy number change of the probe target sequence

141

142

143 Triple X Female Male 283 bp 346 bp detection of Chr X copy number X

144 MLPA discriminates sequences that differ in only a single nucleotide and can be used to detect known mutations MismatchPerfect match Ligation of the two probe oligonucleotides  Amplification product Mismatch at the probe ligation site  No ligation, no amplification product

145 Unmethylated Target M M Methylated Target Denaturation and Multiplex probe hybridization M Only undigested (methylated) and ligated probes are exponentially amplified Ligation and Digestion with methylation sensitive endonucleases M MS-MLPA

146 La tecnica del CGH (comparative genomic hybridization) permette l’individuazione di sequenze delete o duplicate nel genoma da testare (red) mediante il confronto con un genoma di riferimento (green). Sono preparate due sonde fluorescenti di colore diverso che ibridano contemporaneamente sui cromosomi. Se in una regione cromosomica prevale il colore (green) relativo al genoma di controllo questo significa che il genoma da testare (red) ha una delezione in quella regione

147

148


Scaricare ppt "Cromosomopatie Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute."

Presentazioni simili


Annunci Google