La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Corso di Genomica a.a. 2010-2011 lezione 37-38 laurea magistrale Biotecnologia Industriale giovedì 27 Gennaio 2011 aula 6A orario : Martedì ore 14.00 -

Presentazioni simili


Presentazione sul tema: "Corso di Genomica a.a. 2010-2011 lezione 37-38 laurea magistrale Biotecnologia Industriale giovedì 27 Gennaio 2011 aula 6A orario : Martedì ore 14.00 -"— Transcript della presentazione:

1 corso di Genomica a.a lezione laurea magistrale Biotecnologia Industriale giovedì 27 Gennaio 2011 aula 6A orario : Martedì ore Giovedì ore D. Frezza Esami: 24 Febbraio, 3 Marzo, 23 Marzo Lezioni fino al 10 Febbraio

2 Mouse Igh cluster Chromosome 12 Human Igh cluster Chromosome 14 12F1 14q32.33 mta1 JDVJDV JDVJDV crip2crip1hole mta1crip2crip1hole  a  b   JDV   JDV    elk 2.1 hs4hs1.2hs320bp 11 3’  1 hole  elk 2.2 hs4hs1.2hs3 20bp 22 3’  2 hs 4hs 3B hs 1,2hs 3A hs 4 hs 1,2hs 3 hs 4 hs 1,2hs 3 3’  2 3’  1 BAC199M11(AF450245) 86,035,00086,040,00086,045,00086,050,00086,055,00086,065,00086,070,00086,075,00086,060,000 85,894,50085,904,50085,914,50085,924,50085,934,50085,944,50085,954,500 centromerotelomero trascrizione IgH3’RR-1 IgH3’RR-2 (cloni instabili) cluster Ig topo-uomo (duplicazione) TOR VERGATA

3 Tra topo ed uomo qualcosa cambia ma gli enhancers sono gli stessi Cambia l’architettura, ma non il tipo di funzione - c’è stata una duplicazione, ma i geni (o esoni) delle regioni costanti sono gli stessi, ci sono due catene “alfa” e nel topo ce ne è una sola, - ci sono due regioni regolative con 3 enhancers anziché 4 - resta la regione palindromica Differenti strutture: cosa cambia?

4 se nell’uomo ci sono due 3’RR ci sarà un motivo ? 3 domande + 1: è cambiato il sistema di regolazione rispetto al topo ? nell’uomo si possono studiare i polimorfismi (i topi di campagna si allevano male) - dalle diverse forme alleliche si può capire il funzionamento delle due 3’RR ? - hanno tempi di attivazione diversi? perchè due 3’RR ? sono ridondanti ? - si attivano e disattivano in fasi diverse della vita del linfocita B? TOR VERGATA U

5 Confronti RR nei mammiferi

6 Palindrome interna duplicazione umana duplicazione ma anche inversione dx - sin (speculare)

7 Confronto specie RR palindrome Panda 13584bp rabbit mouse dog 19442

8 La palindrome servirà a qualcosa ? Stiamo cercando strutture secondarie 3D Ex-post : se c’è servirà Ma in che modo? dalla struttura alla funzione Topi transgenici deleti: delezione completa e delezioni parziali

9 palindrome 3’RR TOR VERGATA

10 solo HS1.2 è polimorfica gli enhancer HS3 ed HS4 non sono polimorfici HS1.2 è centrale e sta all’interno di una duplicazione non si conosce molto delle funzioni al di là delle regioni conservate contenenti gli enhancers le regioni intermedie sono poco conservate nelle specie anche all’interno dei mammiferi è possibile studiare le assoociazioni nell’uomo tra polimorfismi, funzioni e patologie

11 se regola la risposta immunitaria sul topo molti lavori indicano i meccanismi in cui la 3’RR si inserisce: BCR expression, Ig germline transcription, class switch, B cell maturation (molec e cell biol, topi transgenici) nell’uomo lavori di biologia cellulare-molecolare confermano il ruolo importante delle 3’RR, ma sono due invece di una possibili differenze sull’uomo si studiano i polimorfismi non possibili su topo cosa sono i polimorfismi di HS1.2

12 polimorfismo HS1.2 umana CCCCCCGCCCCCTCCCCCAGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA CACCCCCCCACCA C CTCCAGATTCGGGGACA CACCCCCCCACCA C Sp1 CTCCAGATTCGGGGA NF-  B b 12mer 40mer *1 *2 *3 *4 CAGG End 18mer CTCCAGATTCGGGGA AGGACA AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGA CA CCCCCCCCCCCCAAC AGTGTGGCCAGGCTGGCCCAGGC mer 40mer15mer40mer *1 *2 *3 *4 NF-  B CACCCCCCGCCCCCTCCCC C CTCCACCTGCAGCTGCAGCCGCCACCCACC C ---GGCACATGCAAATGG AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGG A CCCCCCGCCCCCTCCCCC Oct1 18mer 40mer Sp1 core 29mer *1 *2 *3 *4 CTTGCACGAT T NF-  B AGTGTGGCCAGGCTGGCCCAGGCCTCCAGATTCGGGGACA CCCCCCGCCCCCTCCCCC enhancer HS1,2 339 bp 287 bp 465 bp 393 bp EcoRI Oct1 NF-  B Sp1 *2 *1 *3 *4 alleles 3’RR-1 3’RR-2 HS3 HS1.2 HS4 a chrms 14q32 22 33 11 22 44   j V D region 11E  centromere HS3 HS1.2 HS4 TOR VERGATA

13 Internal spacers Conserved sequence Unit Selective amplification of HS1,2-B downstream C  2 (IgH3’RR-2) H  2m HS 3 B B H HS 1,2 EB SA2.5 A2R A2F HS1, bp ALLELE 3B ALLELE 4B Poly A site H  1m B HS 3 BB H*H* B 5402 bp SA2.5 A2R HS1,2 HS 3 Selective amplification of HS1,2-A downstream C  1 (IgH3’RR-1) ALLELE 1A HS1,2 P3Frw D3Rev EcoRI ALLELE 2A ALLELE 3A ALLELE 4A HS 1,2 AB B E Core of enhancer HS1,2 External element - 31 bp Repeated element - 38 bp External element -17 bp EcoRI Ua1 R1R2 U1 U5 U4 U2 U3 R3 rR3 U6U7 U8 U1R1 U2 Ub1 UU 3 4 U5 U6 R3 U8 r U4-5 U7r R3r U6r U5r Ub2 R4 14bp16bp20bp P3Frw HS1,2 D3Rev EcoRI i polimorfismi TOR VERGATA

14 6 alleli Figure 3 polymorphism of HS1,2A Sites for : SP1; IK2; MZF1 Sites for :CEBP; CETS1P54 (-); CMYB; HSF; MEF2; OCT1; SR-Y; STAT; TH1E47; YY1 (-) Sites for : AP4; E47; MYOD;  E5 Sites for : NF-kB Sites for : CMYB ALLELE *4 20bp Sp. 17bp El.END HS1,2 CORE enhancer 17bp El.38bp Rp 14bp Sp. ALLELE *1A 287 ALLELE *2A bp Sp. ALLELE *2B 360 ALLELE *3A 31bp El bp El20bp Sp. 14bp Sp ALLELE *3B 31bp El bp Sp 17bp El 20bp Sp TOR VERGATA

15 Immunology 2001, 103: Polymorphism of the human a1 immunoglobulin gene 3’ enhancer HS1,2 and its relation to gene expression TOR VERGATA U

16 HS fragments are able to synergize with Vk,VH,IgH germline promoters (  2b,  3, ,  ) and non Ig-prmoters (c-myc) so as to enhance the transcription activity in a tissue and stage specific manner. (Ong et al, 1998) Symergic effects TOR VERGATA synergism of HS3A-B-HS1,2-HS4

17 Chromosome 14 IgH3’RR-2 SF AL ( 40 kb) H 22 B HS3 B U2U2 U4U4 U5 B R3 H HS1,2 E R3r U5r U1 R1 U3U3 U6 U7U7 U 8r B U6r HS4 Ub1 U 4-5 R3 U7r Ub2 B H R4 U9U9 R5 Ub3 U 10 R5 U1 1 U 12 R6 SA2.5 A2RA2F Alu U15U16 H LTR END OF HOMOLOGY WITH ALFA1 U14U13 Ub4 H 11 B HS3 B U2 U4 U5 B R3 H*H* HS1,2 E R3rU5r U1R1 Ua1 R2 U3 U6U7U8 B U6r HS4 BH Ua2 R4 Ua3 U9 Ua4 R5 U10 U11 R5 U12 R6 U13 SA2.5 A2R Alu U15 U16 H LTR END OF HOMOLOGY WITH ALFA2 K10 retrovirus ELK2 H U 14 Ua5 A B centromero   33 11 22 44 11   22 clone CHR77 ( kb) Poly A site Poly A site IgH3’RR-1 TOR VERGATA

18 M2M1 ALLELE 1 ALLELE 4 ALLELE 3 ALLELE 2 GRR-1RR-2GRR-1RR-2 CM11CM 4CM 5 GRR-1RR bp 400 bp 200 bp 300 bp gel genomico e selettivo degli alleli amplificazione G=genomica o selettiva RR-1; RR-2 nell’amplificazione genomica si vedono gli alleli delle 2 regioni senza PCR selettiva applicata invece per amplificare selettivamente A o B. TOR VERGATA U

19 i due alleli *2a, *2b e *3a, *3B avevamo visto che nel locus 3’RR-B l’allele *3 aveva l’elemento 31mer rispetto al 17mer del locus 3’RR-A adesso abbiamo (ho) visto che anche l’allele *2 esiste nelle due forme con il 17mer ed il 31mer, cambiano le consensus! allele *4 allele *3 allele *2a allele *2b allele *1 465 bp 393 bp 360 bp 339 bp 287 bp amplificazioni da DNA genomico dalle due 3’RR senza selezione

20 Evoluzione di HS1,2 in diverse specie di mammifero e di primati il core dell’enhancer è più conservata (rosa) ed il 31mer (arancio) potrebbe essere la forma ancestrale stiamo cercando di clonare le forme polimorfiche di altre specie (topo macaco, scimpanzè) per confrontare la funzionalità in cellule di topo e uomo allineamenti TOR VERGATA U

21 conservazione in altre specie Homo s.; Gorilla; Orango; Homo s. allele 4; Cavia; Macaca; Callitrix; Canis; Equus; Felis; Pteropus; Rattus; Mus; Bos; Sus; Callicebus; Monodelphis (opossum);Capra; Gallus.

22 platirrine - catarrine 40 Mya

23 evoluzione della IgH 3’RR

24 strutture conservate di HS1.2 manca la sequenza di Panda uscita il 13 Dicembre 2009

25 evoluzione di HS1.2 TOR VERGATA

26 quali altre analisi ? il polimorfismo si può studiare dal punto di vista funzionale struttura e modelli in “silicio” (transcr. fact.; 3D models) CHIP chromosome immuno-precipitation EMSA electrophoretic mobility shift assay: -incubazione della sonda con le consensus con estratti nucleari -corsa elettroforetica -competizione con anticorpi o con consensus che sottraggono la formazione del complesso e fanno sparire il segnale


Scaricare ppt "Corso di Genomica a.a. 2010-2011 lezione 37-38 laurea magistrale Biotecnologia Industriale giovedì 27 Gennaio 2011 aula 6A orario : Martedì ore 14.00 -"

Presentazioni simili


Annunci Google