La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

La GENETICA DI POPOLAZIONI studia con modelli matematici, a livello di gruppi di individui, la variabilità genetica che è lunico tipo di variabilità rilevante.

Presentazioni simili


Presentazione sul tema: "La GENETICA DI POPOLAZIONI studia con modelli matematici, a livello di gruppi di individui, la variabilità genetica che è lunico tipo di variabilità rilevante."— Transcript della presentazione:

1 La GENETICA DI POPOLAZIONI studia con modelli matematici, a livello di gruppi di individui, la variabilità genetica che è lunico tipo di variabilità rilevante per levoluzione

2 La variabilità genetica può essere studiata a diversi livelli: tra sezioni diverse, ma omologhe, dello stesso genoma tra i due genomi aploidi di una cellula somatica tra cellule somatiche di uno stesso individuo tra gameti di un individuo tra gameti di individui diversi della stessa popolazione (variabilità genetica INTRA-popolazione) tra gameti di individui di popolazioni diverse della stessa specie (variabilità genetica INTER-popolazioni) tra gameti di individui di popolazioni diverse che appartengono a specie differenti (variabilità genetica INTER-specie o filogenetica)

3 La variabilità genetica può essere di estensione e natura differente: estensione da una singola coppia di basi a un intero gene, a regioni multigeniche, fino a segmenti di cromosoma visibili al microscopio ottico o addirittura a interi cromosomi. natura sostituzioni, delezioni, inserzioni, trasposizioni, traslocazioni, duplicazione di interi geni (variabilità del numero di geni) o dimotifs più o meno lunghi disposti in tandem.

4 La variabilità genetica può essere osservata a diversi livelli: morfologico macroscopico o microscopico

5

6 Striatura e colore delle conchiglie della chiocciola Cepaea nemoralis (a) Striata gialla; (b) non striata rosa

7

8 La variabilità genetica può essere osservata a diversi livelli: morfologico macroscopico o microscopico funzionale (ad esempio daltonismo)

9

10 La variabilità genetica può essere osservata a diversi livelli: morfologico macroscopico o microscopico funzionale (ad esempio daltonismo) di proprietà cinetiche di enzimi

11

12 La variabilità genetica può essere osservata a diversi livelli: morfologico macroscopico o microscopico funzionale (ad esempio daltonismo) di proprietà cinetiche di enzimi di comportamento elettroforetico o cromatografico di molecole proteiche

13

14 La variabilità genetica può essere osservata a diversi livelli: morfologico macroscopico o microscopico funzionale (ad esempio daltonismo) di proprietà cinetiche di enzimi di comportamento elettroforetico o cromatografico di molecole proteiche direttamente sul materiale genetico (sequenza di basi o analisi citogenetica)

15

16 La variabilità genetica può essere analizzata con differenti tecniche, alcune di queste sono: sierologiche (es. agglutinazione dei globuli rossi)

17

18 La variabilità genetica può essere analizzata con differenti tecniche, alcune di queste sono: sierologiche (es. agglutinazione dei globuli rossi) elettroforesi di proteine

19

20

21 La variabilità genetica può essere analizzata con differenti tecniche, alcune di queste sono: sierologiche (es. agglutinazione dei globuli rossi) elettroforesi di proteine analisi dellattività enzimatica

22

23 La variabilità genetica può essere analizzata con differenti tecniche, alcune di queste sono: sierologiche (es. agglutinazione dei globuli rossi) elettroforesi di proteine analisi dellattività enzimatica analisi di frammenti di DNA

24 sonda o probe Analisi di un polimorfismo dei frammenti di restrizione o Restriction Fragment Length Polymorphism (RFLP) BamHI* BamHI DNA genomico 7.0 kb 2.4kb4.6kb

25 Analisi di un polimorfismo dei frammenti di restrizione o Restriction Fragment Length Polymorphism (RFLP) soggetti elettroforesi digestione DNA genomico con BamHI

26 M - + Southern blotting Elettroforesi su gel di agarosio 4.0 kb 5.0 kb 6.0 kb 7.0 kb 2.0 kb 3.0 kb

27 tampone di trasferimento Southern blotting peso da circa 500 g gel di agarosio piastra di vetro membrana di nylon (filtro) carta assorbente supporto autoradiografia

28 Ibridazione M membrana di nylon (filtro) esposizione del filtro su lastra autoradiografica M incubazione del filtro con sonda marcata lavaggio del filtro

29 M 4.6 kb 2.4 kb autoradiografia 2.0 kb 3.0 kb 4.0 kb 5.0 kb 6.0 kb 7.0 kb

30 BamHI* DNA genomico primer forward primer reverse Analisi di un polimorfismo per presenza / assenza di un sito di restrizione mediante Polymerase Chain Reaction (PCR) 1.1kb 0.4kb0.7kb

31 elettroforesi digestione prodotto della PCR con BamHI soggetti soggetti PCR

32 M 0.7 kb 0.4 kb 0.35 kb 0.50 kb 0.75 kb 1.25 kb 1.1 kb

33 La variabilità genetica può essere analizzata con differenti tecniche, alcune di queste sono: sierologiche (es. agglutinazione dei globuli rossi) elettroforesi di proteine analisi dellattività enzimatica analisi di frammenti di DNA sequenza del DNA

34

35 GATC GGCCGATAACGTCGGTAATGGGCCGATAACGTCGGTAATG G C G A G A C G T C G/T G T A T G GATC

36 S+S+ S-S- Coppia di geni in una cellula di un organismo diploide S+S+ S-S- Gameti segregazione allelica in una coppia di gameti

37 I gameti a loro volta si accoppieranno per dare origine agli individui della generazione successiva.

38 S+S+ Gameti Zigote omozigote +/+ S+S+ S+S+ S-S- S-S- S-S- S+S+ S+S+ S+S+ S+S+ S+S+ S-S- S+S+ S-S- S-S- S+S+ S+S+ S+S kb 0.4 kb 1.1 kb 5 Soggetto 4

39 S-S- Gameti S-S- S+S+ S-S- S-S- S-S- S+S+ S+S+ S+S+ S+S+ S+S+ S-S- S+S+ S-S- S-S- S+S+ S+S+ S+S+ Zigote omozigote -/ kb 0.4 kb 1.1 kb 5 Soggetti 1 e 3

40 S+S+ S-S- S-S- S-S- S+S+ S+S+ S+S+ S+S+ S+S+ S-S- S+S+ S-S- S-S- S+S+ S+S+ S+S+ S+S+ S-S- Gameti Zigote eterozigote kb 0.4 kb 1.1 kb 5 Soggetti 2 e 5

41 Gli alleli a un locus possono essere anche tre, quattro, …, n. Se indichiamo con n il numero degli alleli di un determinato locus i genotipi possibili di quel locus saranno

42 I genotipi possibili nel caso di due alleli, per esempio S + e S -, saranno quindi S + /S + S + /S - S - /S - (oppure +/+, +/-, -/-)

43 GENOTIPO +/++/--/- totale Numero di individui Numero di alleli Numero di alleli Somma degli alleli + e GENOTIPO +/++/--/- totale Elaborazione dei dati raccolti in un campione analizzato per il polimorfismo presenza / assenza del sito di restrizione BamHI GENOTIPO +/++/--/- totale Numero di individui GENOTIPO +/++/--/- totale Numero di individui Numero di alleli GENOTIPO +/++/--/- totale Numero di individui Numero di alleli Numero di alleli

44 Frequenze alleliche

45 GENOTIPO +/++/--/- totale Numero di individui Numero di alleli Numero di alleli Somma degli alleli + e GENOTIPO +/++/--/- totale Elaborazione dei dati raccolti in un campione analizzato per il polimorfismo presenza / assenza del sito di restrizione BamHI Frequenza allelica di - = 68/128 = Frequenza allelica di + = 60/128 = 0.469

46 Un gene si definisce polimorfico quando il suo allele più comune ha una frequenza Viceversa un gene monomorfico è un gene che non è polimorfico. e il gene più comune ha una frequenza

47 Lerrore della stima di una frequenza può essere calcolata nel modo seguente dove p è la stima della frequenza. IMPORTANTE Questa formula è valida solo se tutti i genotipi sono fenotipicamente visibili NON può essere applicata in caso di alleli recessivi

48 GENOTIPO +/++/--/- totale Numero di individui Numero di alleli Numero di alleli Somma degli alleli + e GENOTIPO +/++/--/- totale Elaborazione dei dati raccolti in un campione analizzato per il polimorfismo presenza / assenza del sito di restrizione BamHI Frequenza allelica di - = 68/128 = Frequenza allelica di + = 60/128 =

49 6 alleli al locus V n = 6

50 A B C campo elettrico alleli Elettroforesi dellenzima PhosphoGlicolato Phosphatase (PGP)

51 GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui ± ± GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A Numero di alleli B GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A Numero di alleli B Numero di alleli C GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A Numero di alleli B Numero di alleli C Somma degli alleli A, B e C GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A Numero di alleli B Numero di alleli C Somma degli alleli A, B e C Frequenza allelica di A = 101/194 = GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A Numero di alleli B Numero di alleli C Somma degli alleli A, B e C Frequenza allelica di A = 101/194 = Frequenza allelica di B = 66/194 = GENOTIPO A/AB/AC/AB/BC/BC/C totale Numero di individui Numero di alleli A Numero di alleli B Numero di alleli C Somma degli alleli A, B e C Frequenza allelica di A = 101/194 = Frequenza allelica di B = 66/194 = Frequenza allelica di C = 27/194 = ± 0.036


Scaricare ppt "La GENETICA DI POPOLAZIONI studia con modelli matematici, a livello di gruppi di individui, la variabilità genetica che è lunico tipo di variabilità rilevante."

Presentazioni simili


Annunci Google