La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Lezione 11-12 RT-PCR 17-11-2006 Analisi della trascrizione tramite PCR Analisi della trascrizione e non determinazione del PM dei trascritti (Northern)

Presentazioni simili


Presentazione sul tema: "Lezione 11-12 RT-PCR 17-11-2006 Analisi della trascrizione tramite PCR Analisi della trascrizione e non determinazione del PM dei trascritti (Northern)"— Transcript della presentazione:

1 Lezione RT-PCR Analisi della trascrizione tramite PCR Analisi della trascrizione e non determinazione del PM dei trascritti (Northern) Analisi dei livelli di trascrizione più fine per la sensibilità del metodo, se si vedessero tramite Northern le stesse quantità il Northern sarebbe più informativo (anche PM) Ampliconi possibilmente a cavallo di introni, perché ?

2 PCR e RT-PCR Nella RT-PCR valgono tutte le stesse regole della PCR, in più ci sono delle differenze dovute alla trasformazione (retrotrascrizione) del mRNA in cDNA. Variabili della PCR : primers (temp. Melting omogenea) specificità di appaiamento assenza di hairpins terminaz. non coesive condizioni di reazione e reagenti conc. polimerasi, Mg, tampone, dNTPs, DNA, primers, temp. e durata dei cicli Nella RT-PCR si deve retrotrascrivere mRNA in cDNA

3 Per RT si intende reverse transcriptase su templato di RNA Per avere un cDNA (DNA complementare ad un RNA messaggero) si deve retrotrascrivere lmRNA cioe farlo diventare DNA I retrovirus ad RNA fanno la sintesi del DNA complementare al loro cromosoma ad RNA tramite una DNA polimerasi specifica che usa come templato RNA anziche DNA. Pero sempre con la sintesi in direzione 5-3come ogni polimerasi. Lenzima reverse transcriptase o trascrittasi inversa che si utilizza non e termoresistente, ma deriva da un retrovirus eucariotico, AMV avian myeloblastosis virus, M-MuLV Moloney leukemia virus murino ed anche altri. Piu recentemente sono state isolate e clonate delle RT mutanti che resistono a temperatura piu alta di 37°C fino a 60°C. Le tecniche precedenti per lo studio della trascrizione erano lanalisi Northern e lisolamento dei cDNA da libraries clonate in vettori vari. RT-PCR da RNA

4 La reverse trascrittasi RT Luso della reverse trascrittasi risale a quando furono scoperti i meccanismi molecolari con cui i virus ad RNA si replicavano allinterno delle cellule infettate. I più utilizzati sono quelli della Murine Moloney leukemia virus MMLV, Avian myeloblastosis virus AMV che poi sono stati anche trasformati per resistere meglio ad alta temperatura per fare la one step RT-PCR Oltre alle RT anche le Taq polimerasi sono state migliorate per efficienza ed affidabilità (riduzione di errori di sintesi).

5 Cosa deve fare la RT Si deve ottenere il retrotrascritto cioè il cDNA ( DNA complementare all mRNA) Si parte da estratti di RNA totali o arricchiti per poly + (A) su resina con oligo dT La retrotrascrizione può avvenire con primers di esanucleotidi random o con poly T, a seconda della lunghezza dei trascritti e se si vogliono tutte le regioni trascritte o sempre a partire dal 3 poliadenilato. RNA è molto instabile e vanno usati degli inibitori delle Rnasi per evitare che si degradino. Il cDNA è molto più stabile e si conserva meglio e più a lungo. Il cDNA si utilizza per la PCR però cè un solo filamento complementare al trascritto con senso 5-3 inverso.

6 RT-PCR dal II filamento in poi Accorgimenti e controlli della RT-PCR Prima di retrotrascrivere il cDNA si tratta lRNA con DNAse per eliminare ogni traccia di DNA genomico che potrebbe dare falsi positivi. Ottenuto il cDNA dalla reverse trascrittasi si passa alla PCR vera e propria con i primers specifici della regione del messaggero che vogliamo amplificare. Come accorgimento si può (si deve quando è possibile) amplificare un amplicone che comprende due porzioni di due esoni diversi e così non si amplifica il frammento di DNA genomico che è molto più lungo in quanto contiene lintrone. Naturalmente la lunghezza dellamplicone è sempre ragionevole e non cè nessun bisogno di amplificare esoni interi, ma sequenze intorno alle 500 pb.

7 Risultati della ricerca sul sito NCBI Primo primer : IGHC-M F CTT CCC GAC TCC ATC ACT TTC TCC Vado su NCBI poi su Blastn seleziono homo sapiens Ottengo molte sequenze della regione della catena pesante delle Ig, scelgo la prima (Length= ) gi| |ref|NG_ | Homo sapiens immunoglobulin heavy locus on chromosome 14 Features in this part of subject sequence: CDS Score = 48.1 bits (24), Expect = 9e-05 Identities = 24/24 (100%), Gaps = 0/24 (0%) Strand=Plus/Plus Query 1 CTTCCCGACTCCATCACTTTCTCC 24 |||||||||||||||||||||||| Sbjct CTTCCCGACTCCATCACTTTCTCC Secondo primer: IGHC-M R GTG GGA CGA AGA CGC TCA CTT TGG Prendo la prima sequenza che è la stessa ottenuta col primo primer Length= gi| |ref|NG_ | Homo sapiens immunoglobulin heavy locus on chromosome 14 Features in this part of subject sequence: CDS Score = 48.1 bits (24), Expect = 9e-05 Identities = 24/24 (100%), Gaps = 0/24 (0%) Strand=Plus/Minus Query 1 GTGGGACGAAGACGCTCACTTTGG 24 |||||||||||||||||||||||| Sbjct GTGGGACGAAGACGCTCACTTTGG Cerco di prendere lintero frammento compreso tra i due primers

8 = analisi della trascrizione di un gene o isolamento di un cDNA senza Northern blot o screening di una cDNA library. La RT-PCR: da RNA totale di cellule per verificare che sia trascritto quel particolare gene. Basta una quantità di RNA molto piccola a differenza di un northern dove per ogni corsa ci occorrono 2-3 g di poly A mRNA o 7-10 g di RNA totale. Nel caso di una cDNA library la quantitainiziale di RNA e di lavoro eassai maggiore. RT-PCR classica: - Primo filamento o con primer di oligo dT o random priming con esanucleotidi. - Lenzima funziona a 37°C; mutanti resistono fino a 60°C. - Si retrotrascrive tutto lmRNA o tutto lRNA, nel caso in cui i trascritti siano molto lunghi e lenzima potrebbe non completare la retrotrascrizione a partire dal polyA. - DallRNA va eliminato il DNA genomico. - Dopo la sintesi del primo filamento di DNA si puo far partire una normale PCR, ma si fa un trattamento di RNase per eliminare lRNA, gli esanucleotidi e loligo dT; ci sono protocolli in cui si fa ununica reazione perche la temperatura della PCR e selettiva e la Taq hot-start non si attiva prima di essere portata oltre 70°C. RT-PCR

9 Accorgimento: quando si estrae lRNA si deve evitare il DNA e si puo fare un trattamento di DNAse, e/o scegliere i primers a cavallo di due esoni I filamento con rev transcript. a bassa temp. II filamento con Taq polymerase, I coppia di primers ( sulla sequenza del mRNA). Non si vede tutto il trascritto, come in un Northern, non se ne puo valutare il peso, ma solo se quel frammento e trascritto (cioe se ce quel mRNA), non si vede lo splicing alternativo salvo scelta dei primers su esoni diversi Valgono tutte le cose che si sanno per la PCR compreso rischio di amplificazioni aspecifiche, la reazione va messa a punto ogni volta. A differenza del Northern la buona amplificazione del frammento (amplicone) puo dipendere non solo dal fatto che ce molto mRNA, ma anche dallefficienza della PCR, quindi non e quantitativa. RT-PCR IV

10 Mutagenesi (sostituzione di basi, singoli nucleotidi, o inserzioni e delezioni), uso di primers modificati. Ricostruzione di un gene senza il templato (recursive PCR,vedi articolo) con amplificazioni successive RACE 3 rapid amplific. of cDNA extremities PCR quantitativa PCR competitiva (costruzione del competitore per inserzione o delezione) SNPS, single nucleotides polymorphisms analysis AFLPs, amplified fragment lenght polymorphisms Screening di libraries in provetta con colture anziche su piastra Altre applicazioni della PCR

11 R.A.C.E. Rapid amplification of cDNA ends 5 or 3 non note -I) retrotrascrizione fatta con primers random o con poly T -quale è la differenza nella scelta di una strategia o dellaltra? -se si cerca il 5 si userà il random priming (esanucleotidi) -se si cerca il 3 si usaerà oligo dT a meno che non si voglia usare un primer specifico anche per la RT mRNA AAAAA 5 3 Con la RT-PCR si amplifica solo un frammento del cDNA Se si vuole identificare lintero cDNA e non si conosce e si vuole evitare lo :screening di una library si può ricorrere alla RACE

12 Differenze nella ricerca di 5 o 3 ignoti mRNA AAAAA 5 3 poly TTTTT 5 3 oligo esa nucleotidi random cDNA primo filamento prodotto dalla RT (completi e non) 5 5 TTT I cDNA ottenuti possono avere estremità diverse a secondo dellefficienza della RT, e dei primers usati

13 Cerchiamo il 3 sconosciuto In questo caso si usa un oligo dT per sintetizzare il cDNA -Prima della RT si può effettuare una reazione di DNase per eliminare il DNA genomico che potrebbe dare falsi positivi perché contamina l RNA e successivamente il cDNA -Dopo la reazione di RT si può fare una reazione di RNase per eliminare RNA RT = reverse transcriptase / trascrittasi inversa cDNA 53 TTTTT regione nota regione ignota


Scaricare ppt "Lezione 11-12 RT-PCR 17-11-2006 Analisi della trascrizione tramite PCR Analisi della trascrizione e non determinazione del PM dei trascritti (Northern)"

Presentazioni simili


Annunci Google