La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Ca 10 13 cellule/individuo. Ciascuna con un genoma nucleare e molti genomi mitocondriali. Il genoma nucleare è composto da ca 4x10 9 coppie di basi, suddivise.

Presentazioni simili

Presentazione sul tema: "Ca 10 13 cellule/individuo. Ciascuna con un genoma nucleare e molti genomi mitocondriali. Il genoma nucleare è composto da ca 4x10 9 coppie di basi, suddivise."— Transcript della presentazione:

1 ca 10 13 cellule/individuo. Ciascuna con un genoma nucleare e molti genomi mitocondriali. Il genoma nucleare è composto da ca 4x10 9 coppie di basi, suddivise in 23 coppie di molecole lineari: i cromosomi. Il più piccolo contiene ca. 50.000.000 di nucleotidi, il più grande ca. 250.000.000. Il Genoma Umano

2 La Biologia Moderna Progetti Genoma: Perchè? La determinazione e la conoscenza dellintera sequenza genomica sembrano essere la condizione necessaria per comprendere la completa biologia di un determinato organismo

3 In che modo? Sequenziamento del DNA significa determinazione della sequenza lineare delle basi che lo compongono, cioè A, T, C e G. Il DNA umano è composto da 3.12 miliardi di paia di basi


5 Un requisito essenziale alla comprensione della biologia completa di un organismo è la determinazione della sequenza del suo intero genoma A prerequisite to understanding the complete biology of an organism is the determination of its entire genome sequence Fleischmann et al. 1995 La Biologia Moderna: i Progetti Genoma


7 2000-2001 Il Genoma Umano completamente sequenziato e assemblato



10 1953 James Watson e Francis Crick determinano la struttura del DNA (La doppia elica) 1977 Gli scienziati americani Allan Maxam and Walter Gilbert e l'inglese Frederick Sanger mettono a punto 2 diversi metodi per sequenziare il DNA, cioè per "leggere" la successione di basi nucleotidiche che lo compongono. Il metodo di Sanger, oggi automatizzato, è quello tuttora utilizzato. 1985 Lo scienziato americano Kary Mullis inventa la PCR, una tecnica che permette di moltiplicare artificialmente il DNA, anche se presente in quantità minima. 1986Il premio Nobel Renato Dulbecco e Leroy Hood lanciano l'idea di sequenziare l'intero genoma Umano. 1990 Negli Stati Uniti nasce ufficialmente lo Human Genome Project (HGP), sotto la guida di James Watson. Negli anni successivi Regno Unito, Giappone, Francia, Germania, Cina si uniscono al progetto formando un consorzio pubblico internazionale. In Italia il progetto genoma nasce nel 1987 ma si interrompe nel 1995. 1992 Craig Venter lascia l'NIH e il progetto pubblico. Fonderà una compagnia privata, la Celera Genomics, portando avanti un progetto genoma parallelo. 1993 Francis Collins e John Sulston diventano direttori rispettivamente del National Human Genome Research Center negli USA e del Sanger Center in Inghilterra, i 2 principali centri coinvolti nel HGP. LE TAPPE DEL PROGETTO GENOMA

11 1999 (Dicembre) Pubblicata su Nature la sequenza completa del cromosoma 22. 2000 (Maggio) pubblicata su Nature la sequenza completa del cromosoma 21. 2000 (Giugno) Francis Collins e Craig Venter annunciano congiuntamente di aver completato la "bozza" del genoma Umano. 2001 La bozza completa del genoma umano (che gli inglesi chiamano working draft) è pubblicata su Nature (quella del consorzio pubblico) e su Science (quella della Celera). Celera Genomics (Applera, Applied Biosystems) Istituzioni pubbliche in: USA, UK, China Francia Germania

12 Dimensioni del Genoma in Megabasi ProcariotiMycoplasma genitalium0.58 Haemophilus influenzae1.83 Escherichia coli 4.7 EucariotiSaccharomyces cerevisiae13.5 Caenorabditis elegans100 Drosophila melanogaster165 Homo sapiens3300 Il genoma di un virus è composto da poche migliaia di bp

13 Genoma Umano > Geni e sequenze associate circa 900.000.000 DNA extragenico circa Codificante 90.000.000 Non codificante 810.000.000 DNA ripetitivo 420.000.000 DNA unico e a basso numero di copie 1.680.000.000 PseudogeniIntroni Regioni di controllo Ripetuto in tandem Satellite Minisatellit iMicrosatelliti Disperso SINELINE Retroposoni Il DNA spazzatura è veramente tale?


15 1-Geni 2-pseudogeni 3-ripetizioni 4-minisatelliti 5-significato ignoto

16 GENI E SEQUENZE CORRELATE -DNA codificante -DNA non codificante



19 Funzione dei geni negli eucarioti superiori Geni che codificano per prodotti proteici; Geni che codificano per RNA non codificanti (RNA-genes).

20 I geni possono essere classificati, oltre che per la funzione, anche per la rappresentatività e per lorganizzazione Geni singoli Geni ripetuti Geni appartenenti a famiglie Geni in clusters Geni interspersi nel genoma

21 CONVENZIONALI: gene inattivato a causa di una o più mutazioni MATURATI: anomala espressione genica PSEUDOGENI: copia non funzionante di un gene

22 Il genoma nucleare contiene una grande quantità di sequenze ripetute che sono in gran parte inattive da un punto di vista trascrizionale A. DNA RIPETUTO IN TANDEM B: DNA RIPETTUTO INTERSPERSO DNA RIPETUTO

23 Classi principali del DNA ripetuto in tandem Il DNA satellite è lungo e ripetitivo (riptetizioni di 171 nucletidi) e costitutisce la massa principale delleterocromatina. E il cosiddetto DNA alfoide o satellite a, 3-5% ogni cromosoma. Funzione poco chiara, probabilmente svolgono un ruolo strutturale. Satellite 2 e 3 contengono schiere di sequenze che si basano sulla ripetizione in tandem ATTCC Il DNA minisatellite è ipervariabile ed è altamente polimorfico. Sono più di 1000 scheramenti (100-20.000 bp) di corte unità ripetute in tandem. La sequenza centrale è GGGCAGGAXG Importante da punto di vista diagnostico: zona del DNA fingerprint. Un minisatellite particolare è costituito dallunità ripetuta TTAGGG (10-15 kb), localizzato nei telomeri. Ha funzione protettiva dei cromosomi. Il DNA microsatellite contine sequenze di 1-4 nucletidi ripetuti in tutto il genoma. Le più comuni sono le dinucletidiche CA (0.5% del genoma; anche questo è altamente polimorfico.

24 Organizzazione dei DNA satelliti nei centromeri

25 DNA RIPETUTO INTERSPERSO Viene suddiviso in due principali famiglie: Short Interspersed Nucleotide Elements; Long Interspersed Nucleotide Elements


27 Il DNA mitocondriale 0.0005% del genoma umano - doppio filamento a diversa composizione: filamento heavy (H) e light (L) - eredita matroclina - contiene 37 geni, 28 su filamento H e 9 su filamento L - dei 37 geni, 24 codificano per prodotti maturi ad RNA e 13 per polipeptidi dei complessi multimerici del mitocondrio (concetto di semiautonomia) - i geni sono estremamente compatti: privi di introni sovrapposti parzialmente (subunita 6 e 8 dellATPasi) trascritti privi di codoni di stop

28 globin Exon 2 Exon 1 Exon 3 5 flanking 3 flanking (chromosome 11) *5.000 *20 6*10 4 bp 3.2*10 9 bp *10 3 3*10 3 bp ATTGCCATGTCGATAATTGGACTATTTGGA30 bp Myoglobin globin aa DNA: Protein: 1 23 4 5 6 7 8 9 X Y 15 14 13 12 10 11 21 20 19 18 17 16 22 279 251 221 197 198 176163148 140 143 148 142 118 107 100 104 88 86 72 66 45 48 163 51 mitochondria.016

Scaricare ppt "Ca 10 13 cellule/individuo. Ciascuna con un genoma nucleare e molti genomi mitocondriali. Il genoma nucleare è composto da ca 4x10 9 coppie di basi, suddivise."

Presentazioni simili

Annunci Google