La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

LINFORMAZIONE GENETICA, ELEMENTO BASILARE: Caratteristiche e alterazioni nei procarioti.

Presentazioni simili


Presentazione sul tema: "LINFORMAZIONE GENETICA, ELEMENTO BASILARE: Caratteristiche e alterazioni nei procarioti."— Transcript della presentazione:

1 LINFORMAZIONE GENETICA, ELEMENTO BASILARE: Caratteristiche e alterazioni nei procarioti

2 IL LEGAME FOSFODIESTERE O - O =P – O – CH 2 Adenina O - O H H H H O O = P O - O CH 2 Timina O H H H H 3 5 ESTREMITA 3 ESTREMITA 5 IL LEGAME FRA NUCLEOTIDI: BASE STRUTTURALE DELLINFORMAZIONE GENETICA

3 O - O = P O - O CH 2 O H H H H O O = P O - O CH 2 O H H H H A:T G:C H H H H O OH CH 2 O P = O O O - H H H H O CH 2 O P = O O O LAPPAIAMENTO DEGLI STRAND: LE BASI COMPLEMENTARI

4 IL CODICE GENETICO UUU F UUC F UUA L UUG L UC S UAU Y UAC Y UAA Stop(Ochre) UAG Stop(Amber) UGU C UGC C UGA Stop(Umber) UGG W CU LCC P CAU H CAC H CAA Q CAG Q CG R AUU I AUC I AUA I AUG M AC T AAU N AAC N AAA K AAG K AGU S AGC S AGA R AGG R GU VGC A GAU D GAC D GAA E GAG E GG G

5 IL GENE PROCARIOTICO ADIACENTI IL GENE PROCARIOTICO E COSTITUITO DA UNA SEQUENZA DI TRIPLETTE ADIACENTI IN UN FILAMENTO DI DNA, IN GRADO DI CONTROLLARE LA SINTESI DI UN PRODOTTO SPECIFICO

6 CLASSIFICAZIONE DEI GENI STRUTTURALI: controllano la sintesi di una proteina enzimatica o strutturale REGOLATORI: controllano la sintesi di una proteina che controlla la trascrizione di uno o più geni agendo su una regione genomica adiacente detta operatore SOPPRESSORI: il loro prodotto sopprime lespressione di uno o più geni agendo a livello della traduzione MUTATORI: il loro prodotto induce alterazioni strutturali in altri geni

7 TGTTGAACATCGATAATTATCTT ACAACTTGTAGCTATTAATAGAA UGUUGAACAUCG ppp OH 5353 TRASCRIZIONE mRNA

8 PROMOTORE GENE TERMINATORE STRUTTURALE Proteina mRNA TRASCRIZIONE TRADUZIONE GENE PROCARIOTICO

9 PROMOTORE ESONI INTRONI TERMINATORE Proteina TRASCRIZIONE RIELABORAZIONE TRADUZIONE 1243 Trascritto primario AAAAAG G Trascritto funzionale GENE EUCARIOTICO

10 1243 LO SPLICING TRASCRITTI FUNZIONALI ALTERNATIVI

11 IL CONTROLLO DELLESPRESSIONE GENICA NON TUTTI I PRODOTTI GENICI SONO NECESSARI ALLO STESSO MOMENTO LESPRESSIONE PUO ESSERE COSTITUTIVAREGOLATA INDUCIBILEREPRIMIBILE

12 oAECDBt TRASCRIZIONE mRNA P TRADUZIONE PROTEINE RNA polimerasi UNITA TRASCRIZIONALE (OPERON) COSTITUTIVA

13 UNITA TRASCRIZIONALE (OPERON) INDUCIBILE oAECDBt NESSUNA TRASCRIZIONE RNA polimerasi R oAECDBt mRNA TRASCRIZIONE RNA polimerasi R I

14 UNITA TRASCRIZIONALE (OPERON) REPRIMIBILE oAECDBt mRNA oAECDBt RNA polimerasi TRASCRIZIONE IR C NESSUNA TRASCRIZIONE RNA polimerasi IR C

15 UNITA TRASCRIZIONALE (OPERON) A CONTROLLO + oAECDBt mRNA oAECDBt RNA polimerasi TRASCRIZIONE AUMENTATA ACT mRNA RNA polimerasi TRASCRIZIONE NORMALE ACT E E

16 IL DNA INVERTIBILE LE VARIAZIONI DI FASE SHIFT DAL FLAGELLO H1 AD H2 IN SALMONELLA H2 e H1rep non trascritti Trascrizione di H1 Trascrizione di H2 e H1rep Il repressore di H1 blocca la trascrizione H2 H1rep H2pro H1 pro ELEMENTO GENETICO INVERTIBILE DALLA DNA INVERTASI (meccanismo flip_flop) H2 H1rep H2pro H1 pro

17 LIMPIEGO DEL CODICE GENETICO CODON AMINOACIDO FREQUENZA DI UTILIZZO IN E.coli FREQUENZA DI UTILIZZO IN H.sapiens CGGArg0,080,19 CGAArg0,050,1 CGUArg0,420,09 AGAArg0,040,21 CCGPro0,550,11 CCAPro0,20,27 CCUPro0,160,29 CCCPro0,10,33 UGAStop0,30,61 UAGStop0,090,17 UAAStop0,620,22

18 UTILIZZO DEI CODON E REGOLAZIONE DELLESPRESSIONE GENICA PROMOTORE GENE 1 GENE2 TERMINATORE mRNA STESSO NUMERO DI COPIE PROTEINA 1 CAI 0,6 tRNA sufficienti CAI 0,1 tRNA limitati PROTEINA 2

19 IL PATRIMONIO GENETICO DEI PROCARIOTI Nucleoide DNA extracromosomiale SITO DI ANCORAGGIO DEL CROMOSOMA ALLA MEMBRANA

20 IL PATRIMONIO GENETICO DEI PROCARIOTI GENERALMENTE 1 MOLECOLA CIRCOLARE DI DNA (eccezioni V.cholerae 2 cromosomi e Agrobacterium e Streptomyces cromosoma lineare) MEDIAMENTE 3-6 x 10 6 bp PESO MOLECOLARE ± 2-4 x 10 9 Da MOLECOLA SUPERAVVOLTA LUNGHEZZA 1,1 mm

21 I PLASMIDI IN NUMEROSE SPECIE BATTERICHE SONO PRESENTI MOLECOLE DI DNA PIU PICCOLE DEL GENOMA, DOTATE DI CAPACITA REPLICATIVA AUTONOMA (PLASMIDI) TALORA IN GRADO DI INTEGRARSI NEL GENOMA (EPISOMI) CHE POSSONO CONFERIRE FENOTIPI RILEVANTI AI BATTERI (VIRULENZA – RESISTENZA)

22 PLASMIDI ARTIFICIALI: PLASMIDI ARTIFICIALI: LA BASE DELLINGEGNERIA GENETICA

23

24 VARIAZIONI FENOTIPICHE FENOMENO ADATTATIVO GRADUALE E REVERSIBILE CUI VA INCONTRO LA MAGGIOR PARTE DELLA POPOLAZIONE IN SEGUITO AD UNA DETERMINATA PRESSIONE AMBIENTALE

25 MUTAZIONI ALTERAZIONI DELLA SEQUENZA GENICA CHE VENGONO EREDITATE DALLA PROGENIE MUTAZIONI ALTERAZIONI DELLA SEQUENZA GENICA CHE VENGONO EREDITATE DALLA PROGENIE ORIGINE DELLA VARIABILITA BATTERICA ANCESTRALE COMUNE EVENTI MUTAZIONALI NUOVI EVENTI MUTAZIONALI EMERGE MUTAZIONE VANTAGGIOSA

26 LAMBIENTE SELEZIONA LE MUTAZIONI FENOTIPO MUTAZIONE VANTAGGIOSA SELEZIONATA STABILMENTE MUTAZIONI GENOTIPICHE PRESSIONE AMBIENTALE

27 LA FREQUENZA MUTAZIONALE 1/10 4 – 1/10 9 PIASTRA SENZA ANTIBIOTICO REPLICA PLATING PIASTRE CON ANTIBIOTICI DIVERSI

28 MUTAZIONI SOSTITUTIVE Errori polimerasi ADDIZIONALI Elementi mobli Errori polimerasi (spesso nonsenso) DELETIVE Errori polimerasi Fenomeni di ricombinazione

29 MUTAZIONI ADDIZIONALI Atgaatagcagacatctgacaattacaatcattgccggcctctcc M N S R H L T I T I I A G L S PROTEINA COMPLETAMENTE ALTERATA AtgaatGagcagacatctgacaattacaatcattgccggcctctccc M N E Q T S D N Y N H C R P L PROTEINA SOPPRESSA AtgaatGGagcagacatctgacaattacaatcattgccggcctctccc M N G A D I - Q L Q S L P A S P PROTEINA CON MUTAZIONE PUNTIFORME AtgaatGGGagcagacatctgacaattacaatcattgccggcctctccc M N G S R H L T I T I I A G L S

30 MUTAZIONI SOSTITUTIVE Atgaattatagacatctgacaattacaatcattgccggcctctcc M N Y R H L T I T I I A G L S PROTEINA NON ALTERATA (MUTAZIONE CONSERVATIVA) AtgaattatagacaCctgacaattacaatcattgccggcctctcc M N Y R H L T I T I I A G L S PROTEINA MUTATA (MUTAZIONE DI SENSO) AtgaattatagacaActgacaattacaatcattgccggcctctcc M N Y R Q L T I T I I A G L S PROTEINA SOPPRESSA AtgaattaGagacatctgacaattacaatcattgccggcctctcc M N - R H L T I T I I A G L S

31 MUTAZIONI E FENOTIPO MUTAZIONI IRRILEVANTI (non vi è sostituzione di amminoacido oppure la sostituzione è conservativa) MUTAZIONI LIEVI (vi è sostituzione di amminoacido non conservativa, ma la proteina mantiene almeno in parte la funzione) MUTAZIONI RILEVANTI (formazione di un prodotto alterato o inattivo o sostanzialmente diverso dalloriginale)

32 MECCANISMI DI MUTAZIONE MUTAZIONE PUNTIFORME CTA/CTC = V/VSILENTE CTA/GTA = V/LCONSERVATIVA CAT/CAA = Q/HNON CONSERVATIVA TAT/TAA = Y/STOPNON SENSO

33 ELEMENTI TRASPONIBILI 1.SEQUENZE DI INSERZIONE 2.TRASPOSONI 3.ALCUNI BATTERIOFAGI TEMPERATI (es. Mu) MECCANISMI DI MUTAZIONE

34 SEQUENZE DI INSERZIONE SONO UN IMPORTANTE MECCANISMO DI DISORGANIZZAZIONE DELLA SEQUENZA NUCLEOTIDICA, IN CUI UNA SEQUENZA PRESENTE IN UNALTRA PARTE DEL GENOMA SI INSERISCE IN UN GENE O NEL SUO PROMOTORE INTERROMPENDOLI O ALTERANDONE LA FUNZIONE. IN MOLTI CASI I SITI DI INSERZIONE NON SONO CASUALI E LE IS SI SPOSTANO IN RISPOSTA A STIMOLI BEN PRECISI. TRASPORTANO IL GENE DI UNA TRASPOSASI E ALLE ESTREMITA GLI INVERTED REPEATS GENE WILD-TYPE GENE INTERROTTO ESPRESSIONE INTERROTTA O ALTERATA IS

35 MECCANISMI DI MUTAZIONE TRASPOSONI SONO UN IMPORTANTE MECCANISMO DI DISORGANIZZAZIONE DELLA SEQUENZA NUCLEOTIDICA. RISPETTO ALLE IS VEICOLANO GENI DI RILEVANTE INTERESSE PER LALTERAZIONE DEL FENOTIPO DEL MUTANTE, COME FATTORI DI RESISTENZA O GENI DI VIRULENZA. INVERTED REPEATS TRASPOSASI GENI DI RESISTENZA O VIRULENZA

36 MECCANISMO DI TRASPOSIZIONE TRASPOSONI TRASPOSIZIONE CONSERVATIVA LELEMENTO TRASPONIBILE SI EXCIDE DAL CROMOSOMA E SI INSERISCE IN UNA NUOVA POSIZIONE SENZA DUPLICARSI SEQUENZA TARGET ELEMENTO TRASPONIBILE

37 MECCANISMO DI TRASPOSIZIONE SEQUENZA TARGET ELEMENTO TRASPONIBILE LA TRASPOSASI INDUCE IL NICKING DEGLI STRAND LELEMENTO TRASPONIBILE SI LEGA AL TARGET SUI DUE STRAND LA POLIMERASI RIPARA LE ZONE SINGLE STRAND DUPLICANDO LE SEQUENZE TARGET

38 MECCANISMO DI TRASPOSIZIONE TRASPOSIZIONE REPLICATIVA (es. FAGO Mu) ELEMENTO TRASPONIBILE TARGET COINTEGRAZIONE NICKING SIINGLE STRAND DEL TARGET E DI Tn E DUPLICAZIONE DI Tn APPAIAMENTO E RICOMBINAZIONE DI Tn

39 SCAMBI GENETICI FRA SPECIE P. putida P. mirabilis V. cholerae Rhizobium trifolii Rodospirillum rubrum P. aeruginosa Azotobacter spp A. calcoaceticus P. fluorescens S. enterica N. subflava A. salmonicida N. gonorrhoeae E. coli S. dysenteriae A. tumefaciens Rhizobium leguminosarum H. influenzae K. pneumoniae S. marcescens B. fragilis B. subtilis B. pumilus S. aureus

40 LA RICOMBINAZIONE GENETICA PROCESSO MEDIANTE IL QUALE DUE MOLECOLE DI DNA REALIZZANO LO SCAMBIO DI REGIONI CON ESTREMITA OMOLOGHE ESTREMITA OMOLOGHE

41 TRASFORMAZIONE (il dna del donatore viene a contatto con il ceppo recettore) CONIUGAZIONE (contatto fisico fra ceppo donatore e ceppo recettore) TRASDUZIONE (il DNA del ceppo donatore è veicolato nel ceppo recettore da un batteriofago temperato) TRE PROCESSI DI RICOMBINAZIONE

42 TRASFORMAZIONE RecA DNA ETEROLOGO CROMOSOMA PROTEINA SPECIFICA ASSOCIATA ALLA COMPETENZA DNA BINDING PROTEIN NUCLEOTIDI NUCLEASI

43 CONIUGAZIONE

44 CONIUGAZIONE F-F- F+F+ PLASMIDE F RETRAZIONE DEL PILO E NICKING DEL PLASMIDE TRASFERIMENTO DI UNO STRAND DA F+ A F- E SINTESI DEGLI STRAND COMPLEMENTARI F+F+ F+F+ SEPARAZIONE

45 REPLICAZIONE E TRASFERIMENTO DEL PLASMIDE CONIUGATIVO DONATORE RICEVENTE PARETI CELLULARI STRAND RITENUTO STRAND TRASFERITO PRIMER DNA POLIMERASI PROTEINE DI MEMBRANA CODIFICATE DAL PLASMIDE OMP SPECIFICHE DEL RICEVENTE PROTEINA TraI NICKING & UNWINDING

46 FORMAZIONI DI CEPPI Hfr I PLASMIDI CONIUGATIVI POSSONO ESSERE EPISOMI ED INTEGRARSI NEL CROMOSOMA FAVORENDO LA SUCCESSIVA MOBILIZZAZIONE DEL CROMOSOMA IS CROMOSOMA MOBILIZZABILE IS oriT IS oriT IS CROMOSOMA STABILE RICOMBINAZIONE

47 TRASDUZIONE DUE PROCESSI DISTINTI TRASDUZIONE GENERALIZZATA UN FRAMMENTO DEL DNA DELLOSPITE, DERIVATO DA UN PUNTO QUALSIASI DEL SUO GENOMA VIENE INCORPORATO NEL GENOMA FAGICO E TRASFERITO TRASDUZIONE SPECIALIZZATA NEL CASO DI ALCUNI FAGI TEMPERATI UNA REGIONE SPECIFICA DEL DNA DELLOSPITE, IN PROSSIMITA DEL PUNTO DI INTEGRAZIONE DEL FAGO, VIENE OCCASIONALMENTE INCORPORATA NEL GENOMA FAGICO E TRASFERITA

48 TRASDUZIONE GENERALIZZATA FAGO CICLO LITICO PARTICELLA TRASDUCENTE RICOMBINAZIONE FAGI CEPPO TRASDOTTO

49 TRASDUZIONE SPECIALIZZATA CEPPO LISOGENO CROMOSOMA DNA FAGICO GENE CROMOSOMIALE EVENTO RARO EVENTO NORMALE


Scaricare ppt "LINFORMAZIONE GENETICA, ELEMENTO BASILARE: Caratteristiche e alterazioni nei procarioti."

Presentazioni simili


Annunci Google