La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Riassumendo Ci sono diverse modalità con cui un gene può produrre trascritti alternativi Ci sono diverse modalità con cui un gene può produrre trascritti.

Presentazioni simili


Presentazione sul tema: "Riassumendo Ci sono diverse modalità con cui un gene può produrre trascritti alternativi Ci sono diverse modalità con cui un gene può produrre trascritti."— Transcript della presentazione:

1 Riassumendo Ci sono diverse modalità con cui un gene può produrre trascritti alternativi Ci sono diverse modalità con cui un gene può produrre trascritti alternativi Inizi alternativi della trascrizione Inizi alternativi della trascrizione Terminazioni alternative della trascrizione Terminazioni alternative della trascrizione Splicing alternativi: Splicing alternativi: Introni trattenuti Introni trattenuti Siti di splicing alternativi Siti di splicing alternativi Esoni cassetta (exon skipping) Esoni cassetta (exon skipping) Esoni mutualmente esclusivi Esoni mutualmente esclusivi Gli esoni che invece sono sempre presenti in tutti i trascritti sono detti esoni costitutivi Gli esoni che invece sono sempre presenti in tutti i trascritti sono detti esoni costitutivi

2 1) Gli introni trattenuti DNA (doppio filamento) Trascritti che mappano sul filamento positivo

3 1) Gli introni trattenuti DNA (doppio filamento) Trascritti che mappano sul filamento NEGATIVO

4 2) Segnali in competizione Trascritti maturi:

5 3) Esoni a cassetta Trascritti maturi:

6 4) Esoni mutualmente esclusivi Trascritti maturi:

7 ... leccezione, oppure la regola? Philip Sharp (premio Nobel 1993): circa il 5% dei geni umani è soggetto a splicing alternativi.. Philip Sharp (premio Nobel 1993): circa il 5% dei geni umani è soggetto a splicing alternativi.. Roberts & Smith (Curr. Op. in Chemical Biology, 2002): circa il 45% Roberts & Smith (Curr. Op. in Chemical Biology, 2002): circa il 45% Progetti trascrittoma... stima: circa, anzi più del 75%! Progetti trascrittoma... stima: circa, anzi più del 75%! Nostra stima… praticamente tutti, purché abbiano più di un esone! Nostra stima… praticamente tutti, purché abbiano più di un esone! Stima ufficiale - come la nostra! Stima ufficiale - come la nostra!

8 Definire gli splicing alternativi Avendo a disposizione sia la sequenza genomica che quella dei trascritti, mappando i differenti trascritti sulla sequenza genomica si osservano a colpo docchio le differenze Avendo a disposizione sia la sequenza genomica che quella dei trascritti, mappando i differenti trascritti sulla sequenza genomica si osservano a colpo docchio le differenze Mentre eventi sul primo (ultimo) esone probabilmente lasciano la proteina inalterata, eventi negli esoni interni cambieranno anche la sequenza codificante del trascritto maturo Mentre eventi sul primo (ultimo) esone probabilmente lasciano la proteina inalterata, eventi negli esoni interni cambieranno anche la sequenza codificante del trascritto maturo

9 Inizi della trascrizione alternativi Cosa può succedere alla regione codificante quando un gene mostra inizi della trascrizione alternativi? Cosa può succedere alla regione codificante quando un gene mostra inizi della trascrizione alternativi? ATG In questo caso, nulla alla CDS: semplicemente si allunga/ accorcia la 5UTR

10 Ma oltre che a bordare la CDS, le UTR al 5 e al 3 servono a qualcosa?... oltre che a bordare la CDS, le UTR al 5 e al 3 servono a qualcosa?

11 ...sì! Produrre un trascritto non implica, necessariamente, che il trascritto venga automaticamente tradotto Produrre un trascritto non implica, necessariamente, che il trascritto venga automaticamente tradotto La 5UTR di solito interagisce con il ribosoma, ma anche con specifiche proteine che si legano al DNA, e che regolano lefficienza della traduzione La 5UTR di solito interagisce con il ribosoma, ma anche con specifiche proteine che si legano al DNA, e che regolano lefficienza della traduzione La 3UTR, di solito, viene attaccata per degradare lmRNA, e quindi regola lefficienza della degradazione (che può avvenire prima che la traduzione sia completa) La 3UTR, di solito, viene attaccata per degradare lmRNA, e quindi regola lefficienza della degradazione (che può avvenire prima che la traduzione sia completa) MORALE: 5 e 3 UTR possono influenzare se/quando/come un trascritto viene tradotto MORALE: 5 e 3 UTR possono influenzare se/quando/come un trascritto viene tradotto

12 Splicing e proteine Un gene (visto classicamente) non produce UN trascritto, ma MOLTI trascritti, che differiscono tra loro per: Un gene (visto classicamente) non produce UN trascritto, ma MOLTI trascritti, che differiscono tra loro per: Inizio/fine della trascrizione Inizio/fine della trascrizione Splicing alternativi (esoni cassetta, esoni alternativi, segnali di splicing alternativi, introni ritenuti) Splicing alternativi (esoni cassetta, esoni alternativi, segnali di splicing alternativi, introni ritenuti) Un gene, quante proteine produce? Un gene, quante proteine produce?

13 Le proteine concettuali Abbiamo a nostra disposizione genomi, e centinaia di migliaia di trascritti/EST Abbiamo a nostra disposizione genomi, e centinaia di migliaia di trascritti/EST In realtà, le sequenze proteiche note (sequenziate) sono poche In realtà, le sequenze proteiche note (sequenziate) sono poche... la maggior parte derivano da traduzioni plausibili dellRNA, oppure della sequenza genomica... la maggior parte derivano da traduzioni plausibili dellRNA, oppure della sequenza genomica Come si predicono, concettualmente, le sequenze di proteine? Come si predicono, concettualmente, le sequenze di proteine?

14 Tradurre i nucleotidi Se la traduzione avviene a triplette, allora ci sono tre modi possibili di tradurre in amminoacidi una sequenza nucleotidica (sempre da 5 a 3!!) Se la traduzione avviene a triplette, allora ci sono tre modi possibili di tradurre in amminoacidi una sequenza nucleotidica (sempre da 5 a 3!!) 5- GATCAGTATGAGGTTAACATAACG - 3

15 Tradurre i nucleotidi La traduzione avviene SEMPRE leggendo la sequenza dal 5 al 3 La traduzione avviene SEMPRE leggendo la sequenza dal 5 al 3 I tre diversi modi di tradurre una sequenza sono detti frame di lettura I tre diversi modi di tradurre una sequenza sono detti frame di lettura E su un doppio filamento di DNA, quanti modi possibili di tradurre la sequenza ci sono? E su un doppio filamento di DNA, quanti modi possibili di tradurre la sequenza ci sono?

16 5- GATCAGTATGAGGTTAACATAACG CTAGTCATACTCCAATTGTATTGC - 5 Tre per filamento, quindi SEI in tutto (indicate con +1,+2,+3 e -1,-2,-3)

17 Le frame di lettura aperte Ovviamente, a noi interessa trovare un codone di start (ATG) e tradurre a partire da quello Ovviamente, a noi interessa trovare un codone di start (ATG) e tradurre a partire da quello La frame che inizia con ATG e termina con un codone di stop è detta frame di lettura aperta (oppure open reading frame, oppure ORF) La frame che inizia con ATG e termina con un codone di stop è detta frame di lettura aperta (oppure open reading frame, oppure ORF)open reading frameopen reading frame Quindi, si cerca innanzitutto un codone ATG Quindi, si cerca innanzitutto un codone ATG

18 Le ORF 5- GATCAGTATGAGGTTAACATAACG e si traduce fino a quando non si trova un codone di STOP nello stesso frame… frame +2

19 Le ORF 5- GATCAGTATGAGGTTAACATAACG -3 |||||||||||||||||||||||| 3- CTAGTCATACTCCAATTGTATTGC e si traduce fino a quando non si trova un codone di STOP nello stesso frame… frame +2 frame -2

20 Annotare un gene I parte Supponiamo di avere a disposizione solo mRNA e genoma (situazione tipica) Supponiamo di avere a disposizione solo mRNA e genoma (situazione tipica) Primo passo: dato un mRNA, predire una regione codificante plausibile Primo passo: dato un mRNA, predire una regione codificante plausibile Si procede sempre da 5 a 3, quindi solo 3 frame di lettura possibili Si procede sempre da 5 a 3, quindi solo 3 frame di lettura possibili Si cerca una frame (ORF) che inizi con ATG, finisca con un codone di stop, e che abbia una lunghezza plausibile (di solito, più di 100 aa) Si cerca una frame (ORF) che inizi con ATG, finisca con un codone di stop, e che abbia una lunghezza plausibile (di solito, più di 100 aa)

21 Annotare un gene, I parte 6 possibili frame di lettura E un mRNA, qual è la soluzione?

22 Annotare un gene II parte Solitamente, va abbastanza bene: si trova ununica regione codificante sensata Solitamente, va abbastanza bene: si trova ununica regione codificante sensata Poi, si mappa il trascritto sul genoma, e se ne determina la struttura esoni/introni, nonché dove vanno a cadere codone di start e di stop Poi, si mappa il trascritto sul genoma, e se ne determina la struttura esoni/introni, nonché dove vanno a cadere codone di start e di stop Ma, tornando ai trascritti multipli e agli splicing, cosa succede alla regione codificante? Ma, tornando ai trascritti multipli e agli splicing, cosa succede alla regione codificante?

23 Splicing e ORF Da anomalia la produzione di trascritti alternativi si è scoperto essere la normalità nei geni degli eucarioti superiori Da anomalia la produzione di trascritti alternativi si è scoperto essere la normalità nei geni degli eucarioti superiori Trascritti alternativi, tramite: Trascritti alternativi, tramite: Inizi alternativi della trascrizione Inizi alternativi della trascrizione Terminazioni alternative della trascrizione Terminazioni alternative della trascrizione Splicing alternativi che coinvolgono gli esoni interni Splicing alternativi che coinvolgono gli esoni interni Quale effetto ha la produzione di trascritti alternativi sul proteoma di un organismo? Quale effetto ha la produzione di trascritti alternativi sul proteoma di un organismo? A ogni trascritto alternativo, corrisponde una proteina alternativa (della tecnicamente isoforma)? A ogni trascritto alternativo, corrisponde una proteina alternativa (della tecnicamente isoforma)?

24 Isoforme A grandi linee gli effetti possono essere riassunti come segue: A grandi linee gli effetti possono essere riassunti come segue: Inizi trascrizione alternativi: Inizi trascrizione alternativi: Allungano o accorciano la 5UTR Allungano o accorciano la 5UTR Aggiungono, rimuovono o modificano lN terminale della proteina codificata Aggiungono, rimuovono o modificano lN terminale della proteina codificata Terminazioni trascrizione alternative: Terminazioni trascrizione alternative: Allungano o accorciano la 3UTR Allungano o accorciano la 3UTR Aggiungono, rimuovono o modificano il C terminale della proteina codificata Aggiungono, rimuovono o modificano il C terminale della proteina codificata Splicing alternativi esoni interni: Splicing alternativi esoni interni: Modificano la regione codificante Modificano la regione codificante

25 ATG alternativi In questo caso, ai 3 inizi di trascrizione alternativi corrispondono 3 ATG alternativi In questo caso, ai 3 inizi di trascrizione alternativi corrispondono 3 ATG alternativi Ovviamente, le tre proteine codificate saranno diverse COME, dipende dal frame di lettura ATG

26 ATG alternativi Consideriamo il secondo esone: se nel primo e secondo trascritto mantiene lo stesso frame, allora la traduzione varia solo nella parte iniziale Consideriamo il secondo esone: se nel primo e secondo trascritto mantiene lo stesso frame, allora la traduzione varia solo nella parte iniziale

27 ATG alternativi IDEM, per il terzo trascritto: se lATG nel secondo esone è nello stesso frame degli altri due, la traduzione da lì in poi sarà uguale IDEM, per il terzo trascritto: se lATG nel secondo esone è nello stesso frame degli altri due, la traduzione da lì in poi sarà uguale

28 Ovvero Parte uguale in tutti i trascritti Dipende dal frame di lettura, e come si arriva nella parte uguale per tutti. Potenzialmente, può essere tradotta in 3 modi diversi. Per avere la stessa cosa, in pratica, la parte codificante variabile allinizio deve essere lunga...

29 Ovvero Parte uguale in tutti i trascritti UN MULTIPLO DI 3!!!!!! In questo modo, le 3 proteine avranno un inizio diverso... ma una fine uguale!

30 Gli spostamenti di frame (frameshift) 5- ATGCAGTCTGAGGTTAACATAACG - 3 immaginiamo di avere una sequenza tradotta in questo modo ATGCTCCAAATGCAGTCTGAGGTTAACATAACG - se aggiungo un multiplo di 3 di nucleotidi la traduzione non cambia ATGCTCCAATGCAGTCTGAGGTTAACATAACG -..ma se non è un multiplo di 3... sposto shift tutto il frame di lettura che avevo prima!!!!

31 Gli spostamenti di frame (frameshift) 5- ATGCAGTCTGAGGTTAACATAACG e se cancello un po di nucleotidi? 5- ATGCAG...GAGGTTAACATAACG - 3 se ne cancello 3 (o multiplo) in frame, cancello esattamente un amminoacido 5- ATGCA...TGAGGTTAACATAACG se ne cancello 3 (o multiplo) NON in frame, cancello un amminoacido e cambio quello adiacente

32 I frameshift 5- ATGCAGTCTGAGGTTAACATAACG ATGCAG..TGAGGTTAACATAACG se ne cancello NON 3 (o multiplo) dal punto di cancellazione in avanti la traduzione è COMPLETAMENTE DIFFERENTE

33 Gli esoni cassetta Le considerazioni appena viste si applicano a inserzioni/cancellazioni dovute ai cassette exon Le considerazioni appena viste si applicano a inserzioni/cancellazioni dovute ai cassette exon se la lunghezza dellesone giallo è un multiplo di 3, allora il suo inserimento causeràsoltanto un inserimento di amminoacidi nella proteina codificata altrimenti, la traduzione dellesone verde sarà DIVERSA a seconda della presenza o meno di quello giallo

34 Siti di splicing alternativi Idem, quando si usano segnali di splicing alternativi Idem, quando si usano segnali di splicing alternativi in questo caso, se la lunghezza del frammento aggiuntivo (in blu) è un multiplo di 3, allora il suo inserimento causeràsoltanto un inserimento di amminoacidi nella proteina codificata altrimenti, la traduzione dellesone giallo e verde sarà DIVERSA a seconda della presenza del frammento aggiuntivo in blu (analogamente quando si accorciano esoni)

35 Gli esoni alternativi Generalmente (ma con moltissime eccezioni) gli esoni altertativi (cassetta et similia) hanno proprio lunghezza multipla di tre e frame +1, quindi aggiungono/tolgono pezzi alla proteina codificata Generalmente (ma con moltissime eccezioni) gli esoni altertativi (cassetta et similia) hanno proprio lunghezza multipla di tre e frame +1, quindi aggiungono/tolgono pezzi alla proteina codificata La modularità nella costruzione della regione codificante, daltra parte, si sposa bene con la modularità che si osserva nella proteine La modularità nella costruzione della regione codificante, daltra parte, si sposa bene con la modularità che si osserva nella proteine

36 I domini delle proteine Una sequenza proteica può essere suddivisa indomini Una sequenza proteica può essere suddivisa indomini Ogni dominio forma la propria strutturaindipendente, ed è responsabile di una delle funzioni della proteina: si può legare ad altre proteine, a ligandi, al DNA/RNA, ecc. Ogni dominio forma la propria strutturaindipendente, ed è responsabile di una delle funzioni della proteina: si può legare ad altre proteine, a ligandi, al DNA/RNA, ecc. In pratica, proteine diverse possono contenere lo/gli stessi domini In pratica, proteine diverse possono contenere lo/gli stessi domini

37 Il gene più famoso del mondo Dominio di legame al DNA Dominio di tetramerizzazione Di solito, 4 catene di p53 sono assemblate insieme

38 Il gene più famoso del mondo

39 Visualizzare gli splicing alternativi

40

41 Sempre il gene più famoso del mondo

42 Domanda!!!! Disegna la struttura di un mRNA, indicandone gli elementi che conosci. Immaginando che lmRNA sia prodotto da un gene con 4 esoni, sul filamento negativo, con codone di start nel secondo esone e stop nellultimo, mappa il trascritto e tutti gli elementi mappabili sulla sequenza genomica Disegna la struttura di un mRNA, indicandone gli elementi che conosci. Immaginando che lmRNA sia prodotto da un gene con 4 esoni, sul filamento negativo, con codone di start nel secondo esone e stop nellultimo, mappa il trascritto e tutti gli elementi mappabili sulla sequenza genomica

43 Morale... Il dogma iniziale: Il dogma iniziale: UN GENE UN GENE UN TRASCRITTO UN TRASCRITTO UNA PROTEINA UNA PROTEINA... è ora diventato..... è ora diventato.. UN GENE UN GENE TANTI TRASCRITTI TANTI TRASCRITTI (POTENZIALMENTE) TANTE PROTEINE (POTENZIALMENTE) TANTE PROTEINE Potenzialmente, perché... non è assolutamente detto che tutti i trascritti prodotti da un gene siano necessariamente codificanti Potenzialmente, perché... non è assolutamente detto che tutti i trascritti prodotti da un gene siano necessariamente codificanti

44 Morale... (2) In origine gli RNA erano o In origine gli RNA erano o Codificanti (mRNA) Codificanti (mRNA) Coinvolti nella traduzione dei mRNA (tRNA, rRNA) Coinvolti nella traduzione dei mRNA (tRNA, rRNA) In realtà, esistono centinaia di RNA non codificanti prodotti da un genoma (miRNA, snoRNA, smallRNA) e così via, con svariate funzioni In realtà, esistono centinaia di RNA non codificanti prodotti da un genoma (miRNA, snoRNA, smallRNA) e così via, con svariate funzioni

45 Per cosa si vince un Nobel, negli anni 2000? Fire & Mello, 1998

46 Morale... (3) Da un trascritto per gene, a molti trascritti per geni... ok? Da un trascritto per gene, a molti trascritti per geni... ok? Ma, in realtà, ci si è resi conto che la trascrizione non sembra essere limitata a quelli canonicamente annotati come geni Ma, in realtà, ci si è resi conto che la trascrizione non sembra essere limitata a quelli canonicamente annotati come geni Foreste di trascritti provenienti da regioni genomiche non limitate solo ai geni (es : RNA antisenso) Foreste di trascritti provenienti da regioni genomiche non limitate solo ai geni (es : RNA antisenso)

47 Morale... (4)... il tutto ha portato a fare un ulteriore passo indietro... ora, molti si chiedono il tutto ha portato a fare un ulteriore passo indietro... ora, molti si chiedono... Dopotutto, che cosè un gene??


Scaricare ppt "Riassumendo Ci sono diverse modalità con cui un gene può produrre trascritti alternativi Ci sono diverse modalità con cui un gene può produrre trascritti."

Presentazioni simili


Annunci Google