La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Università degli Studi di Torino Dipartimento di Genetica Biologia e Biochimica Mario De MarchiAlfredo BruscoSilvia Saviozzi Alessandro Saluto Nicola Migone.

Presentazioni simili


Presentazione sul tema: "Università degli Studi di Torino Dipartimento di Genetica Biologia e Biochimica Mario De MarchiAlfredo BruscoSilvia Saviozzi Alessandro Saluto Nicola Migone."— Transcript della presentazione:

1 Università degli Studi di Torino Dipartimento di Genetica Biologia e Biochimica Mario De MarchiAlfredo BruscoSilvia Saviozzi Alessandro Saluto Nicola Migone Via Santena 19, Torino (Tel )

2 Torta Margherita 200 g fecola di patate 200 g zucchero 4 uova succo di mezzo limone 1 bustina zucchero vanigliato 1 bustina lievito 1 pizzico sale Sbattere bene i tuorli d'uovo con lo zucchero e, sempre mescolando piano piano, aggiungere gradatamente la fecola di patate, il limone, lo zucchero vanigliato, gli albumi montati a neve e, da ultimo, il lievito. Disporre l'impasto in una teglia imburrata e passare in forno appena acceso per circa 25 minuti a temperatura moderata.

3 Il DNA è un codice per la sintesi di proteine

4 La ricetta (=sequenza) del gene ATM GCGAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGA TACTACTTTG ACCTTCCGAGTGCAGTGAGGCATACATCACAATTTGG AATTATGCATTGGTTTATCAATTT ACTTGTTTATTGTCACCCTGCTGCCCAGAT ATGACTTCATGAGGACAGTGA TGTGTGTTCTGAAATTGTGAACCATGAGTCTAGTACTTAATGATCT GCTTATCTGCTGCCGTCAACTAGAAC ATGATAGAGCTACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCT GAAACAATTAAACATCTAG AATTGGGATGCTGTTTTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCAAATGTATCAGCCTCAACAC ATCGGCATTCA GATTCCAAACAAGGAAAATATT TGAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTGGTCAAATACTTCATCAAATGTGCAAACAGAAGAGCACCTAGGCTAAAATGTCAAGAACTCTTAAATTATATCATGGATACAGTGAAAGATTCATCTAATGGT GCTATTTACGGAGCTGATTGTAGCAACATACTACTCAAAGACATTCTTTCTGTGAGAAAATACTGGTGTGAAATATCTCAGCAACAGTGGTTAGAATTGTTCTCTGTGTACTTCAGGCTCTATCTGAAACCTTCACAAGATGTTCATAGAGTTTTAGTGGCTAGAATAATTCATGCTG TTACCAAAGGATGCTGTTCTCAGACTGACGGATTAAATTCCAAATTTTTGGACTTTTTTTCCAAGGCTATTCAGTGTGCGAGACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTCAAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGA ATTAGGAGATGAAATTCTTCCCACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATTGAATTATTTCAACTGCAAATTTATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAAGGTGCTTATGAATCAACAAAATGGAGAAGTATTTTA TACAACTTATATGATCTGCTAGTGAATGAGATAAGTCATATAGGAAGTAGAGGAAAGTATTCTTCAGGATTTCGTAATATTGCCGTCAAAGAAAATTTGATTGAATTGATGGCAGATATCTGTCACCAGGTTTTTAATGAAGATACCAGATCCTTGGAGATTTCTCAATCTTACACTA CTACACAAAGAGAATCTAGTGATTACAGTGTCCCTTGCAAAAGGAAGAAAATAGAACTAGGCTGGGAAGTAATAAAAGATCACCTTCAGAAGTCACAGAATGATTTTGATCTTGTGCCTTGGCTACAGATTGCAACCCAATTAATATCAAAGTATCCTGCAAGTTTACCTAACTGTGA GCTGTCTCCATTACTGATGATACTATCTCAGCTTCTACCCCAACAGCGACATGGGGAACGTACACCATATGTGTTACGATGCCTTACGGAAGTTGCATTGTGTCAAGACAAGAGGTCAAACCTAGAAAGCTCACAAAAGTCAGATTTATTAAAACTCTGGAATAAAATTTGGTGTATT ACCTTTCGTGGTATAAGTTCTGAGCAAATACAAGCTGAAAACTTTGGCTTACTTGGAGCCATAATTCAGGGTAGTTTAGTTGAGGTTGACAGAGAATTCTGGAAGTTATTTACTGGGTCAGCCTGCAGACCTTCATGTCCTGCAGTATGCTGTTTGACTTTGGCACTGACCACCAGTA TAGTTCCAGGAGCGGTAAAAATGGGAATAGAGCAAAATATGTGTGAAGTAAATAGAAGCTTTTCTTTAAAGGAATCAATAATGAAATGGCTCTTATTCTATCAGTTAGAGGGTGACTTAGAAAATAGCACAGAAGTGCCTCCAATTCTTCACAGTAATTTTCCTCATCTTGTACTGGA GAAAATTCTTGTGAGTCTCACTATGAAAAACTGTAAAGCTGCAATGAATTTTTTCCAAAGCGTGCCAGAATGTGAACACCACCAAAAAGATAAAGAAGAACTTTCATTCTCAGAAGTAGAAGAACTATTTCTTCAGACAACTTTTGACAAGATGGACTTTTTAACCATTGTGAGAGAA TGTGGTATAGAAAAGCACCAGTCCAGTATTGGCTTCTCTGTCCACCAGAATCTCAAGGAATCACTGGATCGCTGTCTTCTGGGATTATCAGAACAGCTTCTGAATAATTACTCATCTGAGATTACAAATTCAGAAACTCTTGTCCGGTGTTCACGTCTTTTGGTGGGTGTCCTTGGCT GCTACTGTTACATGGGTGTAATAGCTGAAGAGGAAGCATATAAGTCAGAATTATTCCAGAAAGCCAACTCTCTAATGCAATGTGCAGGAGAAAGTATCACTCTGTTTAAAAATAAGACAAATGAGGAATTCAGAATTGGTTCCTTGAGAAATATGATGCAGCTATGTACACGTTGCTT GAGCAACTGTACCAAGAAGAGTCCAAATAAGATTGCATCTGGCTTTTTCCTGCGATTGTTAACATCAAAGCTAATGAATGACATTGCAGATATTTGTAAAAGTTTAGCATCCTTCATCAAAAAGCCATTTGACCGTGGAGAAGTAGAATCAATGGAAGATGATACTAATGGAAATCTA ATGGAGGTGGAGGATCAGTCATCCATGAATCTATTTAACGATTACCCTGATAGTAGTGTTAGTGATGCAAACGAACCTGGAGAGAGCCAAAGTACCATAGGTGCCATTAATCCTTTAGCTGAAGAATATCTGTCAAAGCAAGATCTACTTTTCTTAGACATGCTCAAGTTCTTGTGTT TGTGTGTAACTACTGCTCAGACCAATACTGTGTCCTTTAGGGCAGCTGATATTCGGAGGAAATTGTTAATGTTAATTGATTCTAGCACGCTAGAACCTACCAAATCCCTCCACCTGCATATGTATCTAATGCTTTTAAAGGAGCTTCCTGGAGAAGAGTACCCCTTGCCAATGGAAGA TGTTCTTGAACTTCTGAAACCACTATCCAATGTGTGTTCTTTGTATCGTCGTGACCAAGATGTTTGTAAAACTATTTTAAACCATGTCCTTCATGTAGTGAAAAACCTAGGTCAAAGCAATATGGACTCTGAGAACACAAGGGATGCTCAAGGACAGTTTCTTACAGTAATTGGAGCA TTTTGGCATCTAACAAAGGAGAGGAAATATATATTCTCTGTAAGAATGGCCCTAGTAAATTGCCTTAAAACTTTGCTTGAGGCTGATCCTTATTCAAAATGGGCCATTCTTAATGTAATGGGAAAAGACTTTCCTGTAAATGAAGTATTTACACAATTTCTTGCTGACAATCATCACC AAGTTCGCATGTTGGCTGCAGAGTCAATCAATAGATTGTTCCAGGACACGAAGGGAGATTCTTCCAGGTTACTGAAAGCACTTCCTTTGAAGCTTCAGCAAACAGCTTTTGAAAATGCATACTTGAAAGCTCAGGAAGGAATGAGAGAAATGTCCCATAGTGCTGAGAACCCTGAAAC TTTGGATGAAATTTATAATAGAAAATCTGTTTTACTGACGTTGATAGCTGTGGTTTTATCCTGTAGCCCTATCTGCGAAAAACAGGCTTTGTTTGCCCTGTGTAAATCTGTGAAAGAGAATGGATTAGAACCTCACCTTGTGAAAAAGGTTTTAGAGAAAGTTTCTGAAACTTTTGGA TATAGACGTTTAGAAGACTTTATGGCATCTCATTTAGATTATCTGGTTTTGGAATGGCTAAATCTTCAAGATACTGAATACAACTTATCTTCTTTTCCTTTTATTTTATTAAACTACACAAATATTGAGGATTTCTATAGATCTTGTTATAAGGTTTTGATTCCACATCTGGTGATTA GAAGTCATTTTGATGAGGTGAAGTCCATTGCTAATCAGATTCAAGAGGACTGGAAAAGTCTTCTAACAGACTGCTTTCCAAAGATTCTTGTAAATATTCTTCCTTATTTTGCCTATGAGGGTACCAGAGACAGTGGGATGGCACAGCAAAGAGAGACTGCTACCAAGGTCTATGATAT GCTTAAAAGTGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTACCAGAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT TTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTA AAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCTTCTTGTATCATGGATGTGTCATTACGTAGCTTCTCCCTTTGTTGTGACTTATTAAG TCAGGTTTGCCAGACAGCCGTGACTTACTGTAAGGATGCTCTAGAAAACCATCTTCATGTTATTGTTGGTACACTTATACCCCTTGTGTATGAGCAGGTGGAGGTTCAGAAACAGGTATTGGACTTGTTGAAATACTTAGTGATAGATAACAAGGATAATGAAAACCTCTATATCACG ATTAAGCTTTTAGATCCTTTTCCTGACCATGTTGTTTTTAAGGATTTGCGTATTACTCAGCAAAAAATCAAATACAGTAGAGGACCCTTTTCACTCTTGGAGGAAATTAACCATTTTCTCTCAGTAAGTGTTTATGATGCACTTCCATTGACAAGACTTGAAGGACTAAAGGATCTTC GAAGACAACTGGAACTACATAAAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGATAATCCGCAAGATGGGATTATGGTGAAACTAGTTGTCAATTTGTTGCAGTTATCCAAGATGGCAATAAACCACACTGGTGAAAAAGAAGTTCTAGAGGCTGTTGGAAGCTGCTTGGGAGA AGTGGGTCCTATAGATTTCTCTACCATAGCTATACAACATAGTAAAGATGCATCTTATACCAAGGCCCTTAAGTTATTTGAAGATAAAGAACTTCAGTGGACCTTCATAATGCTGACCTACCTGAATAACACACTGGTAGAAGATTGTGTCAAAGTTCGATCAGCAGCTGTTACCTGT TTGAAAAACATTTTAGCCACAAAGACTGGACATAGTTTCTGGGAGATTTATAAGATGACAACAGATCCAATGCTGGCCTATCTACAGCCTTTTAGAACATCAAGAAAAAAGTTTTTAGAAGTACCCAGATTTGACAAAGAAAACCCTTTTGAAGGCCTGGATGATATAAATCTGTGGA TTCCTCTAAGTGAAAATCATGACATTTGGATAAAGACACTGACTTGTGCTTTTTTGGACAGTGGAGGCACAAAATGTGAAATTCTTCAATTATTAAAGCCAATGTGTGAAGTGAAAACTGACTTTTGTCAGACTGTACTTCCATACTTGATTCATGATATTTTACTCCAAGATACAAA TGAATCATGGAGAAATCTGCTTTCTACACATGTTCAGGGATTTTTCACCAGCTGTCTTCGACACTTCTCGCAAACGAGCCGATCCACAACCCCTGCAAACTTGGATTCAGAGTCAGAGCACTTTTTCCGATGCTGTTTGGATAAAAAATCACAAAGAACAATGCTTGCTGTTGTGGAC TACATGAGAAGACAAAAGAGACCTTCTTCAGGAACAATTTTTAATGATGCTTTCTGGCTGGATTTAAATTATCTAGAAGTTGCCAAGGTAGCTCAGTCTTGTGCTGCTCACTTTACAGCTTTACTCTATGCAGAAATCTATGCAGATAAGAAAAGTATGGATGATCAAGAGAAAAGAA GTCTTGCATTTGAAGAAGGAAGCCAGAGTACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGTTTACAGGATCTTCTCTTAGAAATCTACAGAAGTATAGGGGAGCCAGATAGTTTGTATGGCTGTGGTGGAGGGAAGATGTTACAACCCATTACTAGACT ACGAACATATGAACACGAAGCAATGTGGGGCAAAGCCCTAGTAACATATGACCTCGAAACAGCAATCCCCTCATCAACACGCCAGGCAGGAATCATTCAGGCCTTGCAGAATTTGGGACTCTGCCATATTCTTTCCGTCTATTTAAAAGGATTGGATTATGAAAATAAAGACTGGTGT CCTGAACTAGAAGAACTTCATTACCAAGCAGCATGGAGGAATATGCAGTGGGACCATTGCACTTCCGTCAGCAAAGAAGTAGAAGGAACCAGTTACCATGAATCATTGTACAATGCTCTACAATCTCTAAGAGACAGAGAATTCTCTACATTTTATGAAAGTCTCAAATATGCCAGAG TAAAAGAAGTGGAAGAGATGTGTAAGCGCAGCCTTGAGTCTGTGTATTCGCTCTATCCCACACTTAGCAGGTTGCAGGCCATTGGAGAGCTGGAAAGCATTGGGGAGCTTTTCTCAAGATCAGTCACACATAGACAACTCTCTGAAGTATATATTAAGTGGCAGAAACACTCCCAGCT TCTCAAGGACAGTGATTTTAGTTTTCAGGAGCCTATCATGGCTCTACGCACAGTCATTTTGGAGATCCTGATGGAAAAGGAAATGGACAACTCACAAAGAGAATGTATTAAGGACATTCTCACCAAACACCTTGTAGAACTCTCTATACTGGCCAGAACTTTCAAGAACACTCAGCTC CCTGAAAGGGCAATATTTCAAATTAAACAGTACAATTCAGTTAGCTGTGGAGTCTCTGAGTGGCAGCTGGAAGAAGCACAAGTATTCTGGGCAAAAAAGGAGCAGAGTCTTGCCCTGAGTATTCTCAAGCAAATGATCAAGAAGTTGGATGCCAGCTGTGCAGCGAACAATCCCAGCC TAAAACTTACATACACAGAATGTCTGAGGGTTTGTGGCAACTGGTTAGCAGAAACGTGCTTAGAAAATCCTGCGGTCATCATGCAGACCTATCTAGAAAAGGCAGTAGAAGTTGCTGGAAATTATGATGGAGAAAGTAGTGATGAGCTAAGAAATGGAAAAATGAAGGCATTTCTCTC ATTAGCCCGGTTTTCAGATACTCAATACCAAAGAATTGAAAACTACATGAAATCATCGGAATTTGAAAACAAGCAAGCTCTCCTGAAAAGAGCCAAAGAGGAAGTAGGTCTCCTTAGGGAACATAAAATTCAGACAAACAGATACACAGTAAAGGTTCAGCGAGAGCTGGAGTTGGAT GAATTAGCCCTGCGTGCACTGAAAGAGGATCGTAAACGCTTCTTATGTAAAGCAGTTGAAAATTATATCAACTGCTTATTAAGTGGAGAAGAACATGATATGTGGGTATTCCGGCTTTGTTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTCAATGGCATGATGAAGAGAGACG GAATGAAGATTCCAACATATAAATTTTTGCCTCTTATGTACCAATTGGCTGCTAGAATGGGGACCAAGATGATGGGAGGCCTAGGATTTCATGAAGTCCTCAATAATCTAATCTCTAGAATTTCAATGGATCACCCCCATCACACTTTGTTTATTATACTGGCCTTAGCAAATGCAAA CAGAGATGAATTTCTGACTAAACCAGAGGTAGCCAGAAGAAGCAGAATAACTAAAAATGTGCCTAAACAAAGCTCTCAGCTTGATGAGGATCGAACAGAGGCTGCAAATAGAATAATATGTACTATCAGAAGTAGGAGACCTCAGATGGTCAGAAGTGTTGAGGCACTTTGTGATGCT TATATTATATTAGCAAACTTAGATGCCACTCAGTGGAAGACTCAGAGAAAAGGCATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAAGATGTTGTTGTCCCTACTATGGAAATTAAGGTGGACCACACAGGAGAATATGGAAATCTGGTGACTATACAGTCAT TTAAAGCAGAATTTCGCTTAGCAGGAGGTGTAAATTTACCAAAAATAATAGATTGTGTAGGTTCCGATGGCAAGGAGAGGAGACAGCTTGTTAAGGGCCGTGATGACCTGAGACAAGATGCTGTCATGCAACAGGTCTTCCAGATGTGTAATACATTACTGCAGAGAAACACGGAAAC TAGGAAGAGGAAATTAACTATCTGTACTTATAAGGTGGTTCCCCTCTCTCAGCGAAGTGGTGTTCTTGAATGGTGCACAGGAACTGTCCCCATTGGTGAATTTCTTGTTAACAATGAAGATGGTGCTCATAAAAGATACAGGCCAAATGATTTCAGTGCCTTTCAGTGCCAAAAGAAA ATGATGGAGGTGCAAAAAAAGTCTTTTGAAGAGAAATATGAAGTCTTCATGGATGTTTGCCAAAATTTTCAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTGGATCCAGCTATTTGGTTTGAGAAGCGATTGGCTTATACGCGCAGTGTAGCTACTTCTTCTATTGTTGGTT ACATACTTGGACTTGGTGATAGACATGTACAGAATATCTTGATAAATGAGCAGTCAGCAGAACTTGTACATATAGATCTAGGTGTTGCTTTTGAACAGGGCAAAATCCTTCCTACTCCTGAGACAGTTCCTTTTAGACTCACCAGAGATATTGTGGATGGCATGGGCATTACGGGTGT TGAAGGTGTCTTCAGAAGATGCTGTGAGAAAACCATGGAAGTGATGAGAAACTCTCAGGAAACTCTGTTAACCATTGTAGAGGTCCTTCTATATGATCCACTCTTTGACTGGACCATGAATCCTTTGAAAGCTTTGTATTTACAGCAGAGGCCGGAAGATGAAACTGAGCTTCACCCT ACTCTGAATGCAGATGACCAAGAATGCAAACGAAATCTCAGTGATATTGACCAGAGTTTCGACAAAGTAGCTGAACGTGTCTTAATGAGACTACAAGAGAAACTGAAAGGAGTGGAAGAAGGCACTGTGCTCAGTGTTGGTGGACAGGTGAATTTGCTCATACAGCAGGCCATAGACC CCAAAAATCTCAGCCGACTTTTCCCAGGATGGAAAGCTTGGGTGTGATCTTCAGTATATGAATTACCCTTTC

5 e la proteina ATM ATM E presente in tutti i tessuti nei soggetti sani E assente o fortemente ridotta nei malati

6 Che cosè una mutazione: un cambiamento nella sequenza del DNA Le mutazioni sono alla base della variabilità genetica, ad es. laltezza, la pressione sanguigna, il colore della pelle. In alcuni casi la variabilità genetica porta ad una malattia genetica

7 Tipi di mutazione Cambia il senso Interrompe il codice ATM 20-40% 60-80%

8 Il gene ATM è uno dei più grandi geni noti ATM Gene medio 2500 basi basi

9 Come si cercano le mutazioni Prelievo di sangue Estrazione del DNA Analisi con tecniche di biologia molecolare (individuano la regione colpita) Lettura della sequenza del DNA Prelievo di sangue Estrazione del DNA Analisi con tecniche di biologia molecolare (individuano la regione colpita) Lettura della sequenza del DNA

10 Perché si cercano le mutazioni Diagnosi certa Identificazione dei portatori Diagnosi prenatale Scopi di ricerca

11 Registro italiano pazienti A-T (RIAT) - Roma-Prof. L.Chessa Pazienti analizzati: 29 I nostri risultati

12 Analisi di mutazioni di ATM mediante PTT mRNA cDNA PCR fragments protein in vitro transcription in vitro translation T7-eu-ATG C C c123 PAGE-SDS cDNA Reverse transcription and nested PCR

13 Interrompono il codice 1240 C T Q414X Gilad C T R805X 5229 A T K1743X Gatti 5574 A T W1858XGilad C T Q2304X 7327 C T R245X 7792 C T R2598X Wright C T K2848X Gatti el al C T R2993X 9139 C T R3065X Gilad 1998 Exon Alcune mutazioni di ATM Cambiano il senso 128 T C L43P Shiloh 7408 T G Y2470D 8708 C T P2903L 8711 A G E2904G Gilad

14 Exon Non senso Delezioni Inserzioni Distribuzione delle mutazioni ATM Difetti di splicing * * * Mutazioni presenti in più famiglie Interrompono il codice Cambiano il senso

15 Conclusioni Sono state individuate il 70% delle mutazioni La proteina può essere colpita in qualunque posizione Sono rare le mutazioni che ricorrono in più famiglie Non è possibile predire landamento della patologia sulla base delle mutazioni Sono state individuate il 70% delle mutazioni La proteina può essere colpita in qualunque posizione Sono rare le mutazioni che ricorrono in più famiglie Non è possibile predire landamento della patologia sulla base delle mutazioni

16 Nuovo progetto Messa a punto di sistemi di analisi di mutazioni mediante DHPLC

17 Analisi di ATM mediante DHPLC Per ogni paziente si eseguono 66 reazioni indipendenti che la macchina analizza in automatico. Se in una reazione si ottiene una possibile mutazione si sequenzia il DNA corrispondente Per ogni paziente si eseguono 66 reazioni indipendenti che la macchina analizza in automatico. Se in una reazione si ottiene una possibile mutazione si sequenzia il DNA corrispondente

18 Prospettive Sistema rapido per analisi di mutazioni Ricerca di tutti i tipi di mutazione Fornire un test per le famiglie che lo richiedano Sistema rapido per analisi di mutazioni Ricerca di tutti i tipi di mutazione Fornire un test per le famiglie che lo richiedano

19 Ringraziamenti Associazione ONLUS Gli Amici di Valentina Associazione ONLUS Gli Amici di Valentina


Scaricare ppt "Università degli Studi di Torino Dipartimento di Genetica Biologia e Biochimica Mario De MarchiAlfredo BruscoSilvia Saviozzi Alessandro Saluto Nicola Migone."

Presentazioni simili


Annunci Google