La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Genetica medica ADI-1 genetica online e clinica Dip. di Genetica Biologia e Biochimica Genetica medica oncologica ASO S. Giovanni.

Presentazioni simili


Presentazione sul tema: "Genetica medica ADI-1 genetica online e clinica Dip. di Genetica Biologia e Biochimica Genetica medica oncologica ASO S. Giovanni."— Transcript della presentazione:

1 Genetica medica ADI-1 genetica online e clinica Dip. di Genetica Biologia e Biochimica Genetica medica oncologica ASO S. Giovanni Battista - Torino IRCC - Candiolo

2 Le malattie genetiche : Malattie causate in modo esclusivo o parziale da un difetto del patrimonio ereditario: difetto nel numero o struttura dei cromosomi -> malattie cromosomiche difetto nella struttura o funzione di un gene -> malattie geniche (monogeniche) (mutazioni del DNA nucleare e mitocondriale) coinvolgimento di una serie di geni localizzati in una stessa regione genomica (riarrangiamento) -> malattie genomiche

3 Le malattie genetiche : effetto di modificazioni chimiche e strutturali del DNA in grado di alterare lespressione di un gene o di un gruppo di geni -> malattie epigenetiche (difetti di imprinting) effetto dellinterazione tra geni e ambiente -> malattie multifattoriali o complesse

4 March 20,

5 March 24,

6 March 24, 2004March 20, 2005April 19, 2006

7

8 Perché occuparci di questi casi da un punto di vista genetico ? tumori giovanili, multipli, bilaterali fanno sospettare una predisposizione i soggetti già malati potrebbero sviluppare altri tumori altri membri della famiglia potrebbero ammalarsi parenti sani ma preoccupati di potersi ammalare in futuro potrebbero non avere ereditato il difetto genetico la causa genetica (biochimica) di una malattia potrà in futuro essere corretta ?! diagnosi corretta gestione clinica identificazione dei portatori identificazione dei non portatori ricerca

9 Ricerca basata sul sintomo Feocromocitoma famigliare Feocromocitoma + angioma midollare National Center for Biotechnology Information NCBI : –Pubmed, OMIM –> VHL, RET, SDH-B, SDH-C, SDH-D Gene Test –> Gene Review Cancer Prone Diseases

10 parathyroid hyperplasia pheochromocytoma medullary thyroid carcinoma neuroendocrine pancreatic tumors MEN2 pituitary adenoma duodenal gastrinomas carcinoids exc. MEN1 retinal angiomas CNS haemangioblastomas renal cell carcinomas VHL para- ganglioma SDH genes

11 Predisposizioni ereditarie allo sviluppo del feocromocitoma e paragangliomi extra-surrenalici Casi di feocromocitoma isolato, non-sindromico (surrenalico, extra-surrenalico) –11% VHL (per lo più mutazioni missenso) –5% RET (per lo più mutazioni esoni 11 e 13) –4.5% SDHB –4% SDHD Tot 24% (70% <10 yr, 51% < 20 yr; 39% < 30 yr, 27% < 40 yr, 18% < 50 yr) (80% se multifocale)

12 Paziente di anni a 42 anni: feocromocitoma bilaterale - non altre manifestazioni cliniche di VHL (fondo oculare negativo, RM encefalo e midollo negativa, TC addome negativa) Genitori deceduti: - madre a 71 anni per emorragia cerebrale - padre a 65 anni per coma diabetico Una sorella deceduta a 31 anni per complicanze post-operatorie di intervento neuro-chirurgico per angioma midollare.

13 Impostazione del test genetico Ricerca di mutazioni e delezioni gene VHL Se negativo, –analisi RET e SDH-B, SDH-C, SDH-D Acquisizione della sequenza genomica del gene VHL ( Entrez Gene, Ensemble: ) -ricerca di mutazioni puntiformi: PCR e sequenza -ricerca di delezioni genomiche

14 Denaturazione 95°C Appaiamento inneschi Sintesi del DNA 72 °C (Taq polimerasi) Ciclo 1 Appaiamento inneschi Ciclo 2 Sintesi del DNA PCR

15 N° cicli N° sequenze bersaglio PCR : Reazione a Catena della Polimerasi Per lanalisi di una digestione con enzimi di restrizione tale da poter essere visibile in elettroforesi occorre ~1 g di DNA. Se vi sono ~5 pg di DNA/cellula umana (5x g) allora ~1 g of DNA potrebbe essere isolato da cellule ma avremmo un miscuglio di tutti i geni. In 1 g di DNA genomico, una copia singola di un esone (300 bp) equivarrebbe a ~0.1 pg di DNA. Questo 0.1 pg di DNA potrebbe essere amplificato mediante PCR producendo 0.8 g in 25 cicli e 27 g in 30 cicli.

16 Sequenziamento del DNA (1): strutture dei nucleotidi

17 Sequenziamento del DNA (2): il metodo di Sanger Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica il primer (lungo 15 nucleotidi) ** I dNTP sono ad una concentrazione 100 volte superiore di quella dei ddNTP in ciascuna provetta

18 Sequenziamento del DNA (3): il metodo di Sanger pozzetti autoradiogramma Si legga la sequenza man mano sintetizzata dal basso verso l alto. Il nucleotide G è il più vicino al primer (estremità 5) mentre il nucleotide T è allestremità 3.

19 361G>A Caso indice: sequenza senso (forward) Caso indice: sequenza anti-senso (reverse) 541 CACAGCTACCGAGGTCACCTTTGGCTCTTCAGAGATGCAGGGACACACGATGGGCTTCTG 110 -H--S--Y--R--G--H--L--W--L--F--R--D--A--G--T--H--D--G--L--L-

20 codifica mutazione c.365G>A (p.D121N) GAT>AAT: Asp121Asn Acido Aspartico -> Asparagina aa acidoaa polare DB SNPs: Segnalato in precedenza SNP D121G senza info DB mutazioni: The Human Gene Mutation Database : -> report 1994 D121G in un paz. con feocromocitoma COOH | 2HN -- CH | CH2 | COOH | 2HN -- CH | CH2 | CO--NH2

21 VHL protein beta-domain 7 stranded sandwich: aa (HIF1 binding: aa ) H4: aa polar interface between and domains Linker: aa alpha-domain aa H1 – H2 – H3 Linker: aa Stebbins CE et al Science 1999

22 VHL – interface Stebbins CE et al Science 1999 Polar interface between alpha and beta domain Hydrogen bonds involving: amino acids: H3Asp187, Leu188 H1Glu160, Arg161, Gln164, Arg167 amino acids: L6Asp121, Thr124, Asp126 L2Arg82

23 Feocromocitoma non sindromico giovanile in due fratelli Programma: - ricerca di mutazioni RET e SDH - se negativo: analisi VHL

24

25 467A>C Caso indice Madre 661 AATATCACACTGCCAGTGTATACTCTGAAAGAGCGATGCCTCCAGGTTGTCCGGAGCCTA 150 -N--I--T--L--P--V--Y--T--L--K--E--R--C--L--Q--V--V--R--S--L-

26 DB SNPs: NON segnalati SNPs in 156 DB mutazioni: The Human Gene Mutation Database : -> 3 report anche recenti di mutazioni: Y156D, Y156N, Y156C codifica mutazione c.467A>C (p.Y156S) TAT>TCT: Tyr156Ser Tirosina -> Serina aa idrofobico aromaticoaa polare sottile polare COOH | 2HN -- CH | CH2--OH COOH | 2HN -- CH | CH2 | OH

27 VHL - Elongin C interface Most relevant contact: Leu158 – Cys162 – Arg161 Hydrogen bonds: Arg82 – Arg161 – Lys159 Stebbins CE et al Science 1999

28 Effetto delle mutazioni missenso cambiamento aminoacidico +- conservativo frequenza nella popolazione generale segregazione nellambito della famiglia effetto prevedibile sulla struttura/funzione della proteina (modeling) conservazione nellevoluzione test funzionale (ev. second hit)

29 SIFT Sorting Intollerant From Tollerant D121N con nematodi0.13 senza nematodi0.00 Y156S con nematodi0.26 senza nematodi0.22 Y156D con nematodi0.13 senza nematodi0.11 Y156N con nematodi0.20 senza nematodi0.17 Y156C con nematodi0.11 senza nematodi0.09

30 Geni RECESSIVI entrambi gli alleli inattivati : delezioni o riarrangiamenti cromosomici mutazioni puntiformi iper - metilazione 2 mutazioni somatiche tumore sporadico 1 costituzionale + 1 somatica tumore ereditario Inattivazione di geni onco - soppressori : perdita di funzione

31 Gene onco-soppressore Rb Alleli Rb normali mutazione somatica Retinoblastoma unico mono-laterale Mutazione germinale mutazione somatica Retinoblastomi multipli bilaterali ad insorgenza precoce

32 Inattivazione di geni onco - soppressori con perdita di eterozigosità (LOH) Prima mutazione: puntiforme seconda mutazione: delezione Allele Allele Allele Allele Allele 8 Allele 2 3 6

33 Inattivazione di geni onco - soppressori con perdita di eterozigosità (LOH) Allele Allele Allele 8 Allele Loci studiati: 1234 Caso 1ni--+ Caso Caso 3++-ni Allele Allele Allele 1 8 Allele Allele Allele Allele 5 3 Allele Sede del gene onco-soppressore Tessuto sano Tessuto tumorale


Scaricare ppt "Genetica medica ADI-1 genetica online e clinica Dip. di Genetica Biologia e Biochimica Genetica medica oncologica ASO S. Giovanni."

Presentazioni simili


Annunci Google