La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Più generazioni interessate tramissione da parte di entrambi i sessi circa il 50% dei soggetti affetti maschi e femmine affetti non segni di consanguineità

Presentazioni simili


Presentazione sul tema: "Più generazioni interessate tramissione da parte di entrambi i sessi circa il 50% dei soggetti affetti maschi e femmine affetti non segni di consanguineità"— Transcript della presentazione:

1 più generazioni interessate tramissione da parte di entrambi i sessi circa il 50% dei soggetti affetti maschi e femmine affetti non segni di consanguineità Ereditarietà autosomica dominante

2 - ogni tratto o carattere che si esprima nell eterozigote - nel caso di malattia: una sola copia del gene mutato è sufficiente per esprimere il fenotipo affetto Trasmissione ereditaria dei caratteri mendeliani Codominante: leterozigote esprime un fenotipo distinto da quello dei due stati omozigoti per es. gruppi sanguigni, enzimi eritrocitari, etc. Genotipo : eterozigote Fenotipo : affetto Dominante

3 Se un genitore è normale (bb) e laltro è affetto (Bb) da una malattia autosomica dominante, il 50% dei figli sarà eterozigote affetto (Bb), ed il 50% sarà omozigote normale (bb). Nelle malattie autosomiche dominanti, la lettera maiuscola indica il gene che dà la malattia: un solo allele mutato dà origine al fenotipo affetto Eredità autosomica dominante Rischio di ricorrenza = 50% (0.5)

4 Se entrambi i genitori sono affetti (Bb) da una malattia autosomica dominante, allora il 75% dei figli sarà affetto (BB o Bb), e il 25% sarà omozigote normale (bb). Nota: è raro che un individuo affetto da una malattia autosomica dominante sia omozigote per il gene che dà la malattia. Eredità autosomica dominante

5 si manifesta in uguale misura nei due sessi la trasmissione non dipende dal sesso il figlio di un genitore affetto e di uno sano ha il 50% di probabilità di essere affetto un individuo affetto ha comunemente un genitore affetto …………….mutazioni de novo individui non affetti non trasmettono la malattia ….……penetranza incompleta Eredità autosomica dominante

6 Carattere AD a penetranza completa tasso di nuove mutazioni R = 0.5 (50%) Carattere AD a penetranza incompleta (penetranza del 70%) R (III-1) = 0.5 ??? R (IV-1) = 0.25 ??? III-2 III-1

7 III-2 III-1 Teorema di Bayes: Rischio di ricorrenza III-1 Ipotesi 1 Ipotesi 2 Portatore Non Portatore 1 / 2 1 / 2 prior p. 3 / 10 1 conditional p. ½ x 3/10= 3/20 ½ x 1=1/2 joint p. 3/201/2 3/20 + 1/2 1/2 + 3/20 posterior p. = 3/13 (23%) = 10/13 (77%) R (III-1) di trasmettere = ½ x 3/13 = 3/26 (11.5%) R (III-1) di avere un figlio affetto = 3/26 x 7/10 = 8%

8 Mutazioni nuove o de novo oogenesi spermatogenesi Nuova mutazione mosaicismo identificate nelle malattie dominanti o recessive X-linked, molto raramente producono malattie autosomiche recessive (entrambe le copie del gene devono essere mutate) il rischio di ricorrenza è basso ma leggermente superiore allincidenza della malattia nella popolazione a causa del mosaicismo della linea germinale

9 Aspetti da considerare nelle malattie AD Penetranza- completa – incompleta - diversa per fasce di età Espressività- presenza – assenza - espressività variabile Tasso di nuove mutazioni casi sporadici – famigliari Percentuale di mosaicismi germinali

10 Retinoblastoma (1: ) Rb Retinoblastoma sporadico monolaterale unico Rb bilaterale Rb multifocale monolaterale 60% dei casi40% dei casi espressività variabile penetranza >90% Ipotesi: mosaicismo germinale o somatico

11 Retinoblastoma f 1 : nati 60% dei casi: tumore monolaterale unico –inattivazione somatica di Rb1 (-/-) 40% dei casi: tumore multifocale e/o bilaterale con storia famigliare POSITIVA –trasmissione AD di mutazione Rb1 (-/+): –inattivazione somatica del secondo allele (-/-) con storia famigliare NEGATIVA –mutazione de novo in un gamete (maschile) –mosaicismo germinale in un genitore (6-10%) –mosaicismo somatico nellaffetto (10%) RR=0.5, RT=0.5 RR=??, RT=??

12 Gene Rb1 13q14: 27 esoni, mRNA 4,840, proteina 928 aa più di 400 mutazioni note –85-90% mutazioni troncanti (NS, FS, SS): esoni 2-25

13 SCA : - che tipo di ereditarietà - qualè la probabilità di essere portatore per il padre e per la probanda - è possibile eseguire un test genetico ? A che scopo ? - a chi offrirlo

14 SCA : - che tipo di ereditarietà - qualè la probabilità di essere portatore per il padre e per la probanda - è possibile eseguire un test genetico ? A che scopo ? - a chi offrirlo Autosomica Dominante Ipotesi 1 Ipotesi 2 Portatore Non Portatore 1 / 2 1 / 2 prior p. 2 / 10 1 condit. p. ½ x 2/10= 2/20 ½ x 1=1/2 joint p. 1/10 1/2 1/10 + 1/2 1/2 + 1/10 post. p. = 1/6 (16.6%) = 5/6 (83.3%) Probanda: 1/6 x ½ = 1/12 (8.3%) Test ai membri affetti - conferma della diagnosi - esclusione certa dei non portatori - definizione del RR della probanda

15 Ripetizioni normali Ripetizioni patologiche Malattia (9 forme) Locus Frequenza tra le ADCA (Italia) Caratteristiche distintive SCA2 12q24.1CAG/ % movimenti saccadici lenti, neuropatia periferica SCA3 14q21CAG/ <1% nistagmo, retrazione delle palpebre, fascicolazioni amiotrofiche SCA6 19p13.1CAG/ 4-18(19)20-33<1% atassia episodica, decorso molto lento SCA7 3p21.1-p12CAG / >300<1% perdita della vista con neuropatia 6p23CAG/ % segni piramidali, neuropatia periferica SCA1 SCA10 22q13ATTCT/ assente attacchi epilettici occasionali SCA12 5q31CAG / assente tremori precoci, demenza tardiva SCA8 13q21CTG/ <1% DTR vivaci e diminuzione della sensibilità vibratoria SCA17 6q27CAG/ <1% deterioramento mentale

16 MalattiaLocus Caratteristiche distintive SCA4 16q22.1 neuropatia assonale sensitiva Yellow: loci with published markers 11p12 1 (Lincoln) insorgenza precoce, decorso lento SCA9 X (riservato) SCA13 19q131 (french) lieve ritardo mentale, bassa statura SCA14 19q13.4 mioclono assiale precoce SCA16 8q (japan) progressione lenta, rigidità, tremore 3pter (australian) atassia pura e progressione lenta SCA15 SCA20 N° di famiglie descritte 2 (U.K.) lieve, rimane la deambulazione SCA11 15q14 -q21 1p21-q21 1 (french) neuropatia sens., atrofia musc. SCA18 SCA21 SCA19 SCA22 SCA5 SCA : 13 loci noti riservato 7p21.3-p15.1 1q22 (riservato) 7q31-32 >5 (japan/scand.) 2 (japan/english) ? 1 (dutch) tremore della testa lieve atassia, segni piram., dist. cogn.

17 una sola generazione interessata ramo paterno a materno sani maschi e femmine affetti talora segni di consanguineità Ereditarietà autosomica recessiva

18 Recessiva : ogni tratto o carattere che si esprima solo nell omozigote nel caso di malattia: entrambe le copie del gene mutato devono essere presenti per esprimere un fenotipo affetto Trasmissione ereditaria dei caratteri mendeliani I fenotipi possono essere analizzati e misurati a differenti livelli. Es. malattie metaboliche: gli eterozigoti sono sani ma lenzima responsabile della malattia può avere nel siero una concentrazione intermedia rispetto a quella dei due stati omozigoti. Genotipo : eterozigote Fenotipo : portatore sano Genotipo : omozigote Fenotipo : affetto

19 Se un genitore è normale (AA) e laltro è portatore (Aa), allora il 50% in media dei figli sarà omozigote normale (AA), e laltro 50% sarà portatore eterozigote non affetto (Aa). Non vi sono figli affetti. Nel caso di malattie autosomiche recessive, le lettere minuscole stanno ad indicare i geni che in omozigosi danno la malattia, perché entrambi gli alleli devono essere mutati perché si osservi il fenotipo patologico. Qualè la probabilità di avere un figlio affetto se entrambi i genitori sono portatori? Eredità autosomica recessiva a a a

20 Se entrambi i genitori sono portatori sani (Aa), in media il 25% dei figli sarà omozigote normale (AA), il 50% sarà eterozigote non affetto (Aa), e il 25% sarà omozigote affetto (aa). Se un genitore è un portatore sano (Aa) e laltro è affetto (aa), allora il 50% in media dei figli sarà eterozigote non affetto (Aa), e laltro 50% sarà omozigote affetto (aa). Eredità autosomica recessiva

21 gli individui affetti sono omozigoti (o eterozigoti composti) nella maggior parte dei casi, entrambi i genitori sono portatori sani – in media, 1 su 4 figli è affetto la trasmissione non dipende dal sesso matrimoni tra individui affetti e non affetti genera solo figli eterozigoti sani – a meno che il partner non affetto sia eterozigote più è rara la malattia, più è probabile che lindividuo affetto sia figlio di genitori tra loro consanguinei (inbreeding) Eredità autosomica recessiva

22 AaAa AaAa aa ? Qual è la probabilità di avere un figlio affetto per III-2 ? Probabilità di essere portatore: ½ Probabilità che la coniuge sia portatrice: f portatori nella popolazione ½ x f x ¼ AA+Aa III-2

23 Frequenza (f) dei portatori nella popolazione generale Legge di Hardy-Weinberg p frequenza allele normale (A) q frequenza allele mutato (a) i genotipi nella popolazione saranno : p 2 + q 2 + 2pq = (p + q) 2 dove p + q = 1 Conoscendo la frequenza degli affetti : q 2 (aa) p = 1 - q 2 2pq (f portatori) = 2 (1 - q 2 ) q 2

24 Legge di Hardy-Weinberg p 2 : q 2 : 2pq La distribuzione binomiale presume che : la popolazione sia ampia gli incroci siano casuali le frequenze alleliche siano costanti - frequenza di nuove mutazioni - fitness riproduttiva degli omozigoti affetti - deriva genetica - vantaggi degli eterozigoti - migrazioni

25 AyAy AxAx xy ? Qual è la probabilità di avere un figlio affetto per III-2 ? ½ x f x ¼ -> testing genetico risolutivo Se III-2 è Ay = RR= 1 x f x ¼ Se III-2 è AA = RR pressochè nullo Se lindividuo IV-2 ha un genotipo noto: mutX/mutY AA+Ay

26 A?A? AxAx x? ? Qual è la probabilità di avere un figlio affetto per III-2 ? ½ x f x ¼ Stato genetico di III-2 indeterminato RR= ½ x f x ¼ Se III-1 (coniuge) ha un test genetico negativo : RR = ½ x f (sensibilità del test) x ¼ Se nellindividuo IV-2 il test genetico ha permesso di identificare una sola mutazione (mutX)

27 Dominanza o Recessività Dipende da : caratteristiche della malattia ? caratteristiche del gene ? effetto biologico delle mutazioni ? effetto biologico delle mutazioni in relazione alle caratteristiche funzionali della proteina (prodotto genico)

28 Malattie ereditarie recessive Mutazioni che inducono una perdita di funzione Gli eterozigoti (portatori) sono normali, una riduzione del prodotto proteico del 50% viene tollerato se il rimanente 50% è sufficiente per una funzione normale Esempio: tratto falcemico, A S Gli omozigoti sono affetti perché non viene prodotta proteina o quella che è prodotta non funziona normalmente Esempio: anemia falciforme, S S difetti enzimatici recessivi, fibrosi cistica

29 Mutazioni delle serpine (inibitori delle serin-proteasi) 1-antitripsina anti-elastasi dei neutrofili antitrombina anti-proteasi della coagulazione inibitore di C1 anti-attivazione del complemento inibitori della plasmina anti-fibrinolisi

30 mutazioni loss of function : ins o del (frame shift) deficit di enzima circolante eccesso di attività dellelastasi leucocitaria enfisema mutazioni missenso del sito reattivo : Met358Arg conversione in antitrombina malattia emorragica fatale mutazioni missenso nella regione mobile o sheet : Glu342Lys polimerizzazione della serpina accumulo negli epatociti (ER) fibrosi portale cirrosi ed epatocarcinoma (colangiocarcinoma) Mutazioni dell1-antitripsina (AR) (inibitore dellelastasi dei neutrofili)

31 Connessina 26 GJB2 (Gap Junction Beta 2) proteina di 226 aa esamero (connessone): canale del potassio espressione: stria vascolare, legamento spirale, tra le cellule di sostegno nella coclea, cute elevato contenuto di K+ nellendolinfa

32 35 G In Italia : in omozigosi o in eterozigosi composta nel 40% circa di tutti i casi di sordità congenita non sindromica recessiva Connessina 26 GJB2 (Gap Junction Beta 2) frameshift e stop

33 Connessina 26 GJB2 (Gap Junction Beta 2) Alleli dominanti : sordità post-linguale progressiva AD C202F W44C

34 Connessina 26 GJB2 (Gap Junction Beta 2) G59A D66H R75W Alleli dominanti : Sindrome di Vohwinkel : sordità congenita AD ipercheratosi palmo-plantare

35 Fibrosi cistica (AR, 1/2500) malattia cronica polmonare –ostruzione diffusa delle vie aeree di piccolo calibro –infezioni polmonari ricorrenti, fibrosi, cisti, ascessi anomalie gastrointestinali e malassorbimento –Ileo da meconio (15-20%) –insufficienza pancreatica, pancreatite cronica (92%) –malattia epato-biliare cronica (6%) –ostruzione intestinale, prolasso rettale –malassorbimento (vit. liposolubili), ritardo di crescita azoospermia ostruttiva –assenza dei vasi deferenti –azoospermia, ridotto liquido seminale, pH<7 sindromi da perdita di Sali sopravvivenza: 31.6 aa (56aa ps – 20-25aa pi)

36 Tripsinogeno immunoreattivo –screening neonatale Test del sudore –Cl > 60mEq/L in due separati dosaggi –in una quantità di almeno 75mg (30 minuti) Potenziale nasale di trans-membrana –dopo i sei anni (potenziale più negativo) Analisi genetica per la ricerca di mutazioni frequenti Ricerca di mutazioni di secondo livello Fibrosi cistica (AR, 1/2500)

37 7q31.2 gene CFTR 27 esonimRNA: 6128 b 1480 aa

38 Mutazioni CFTR e Fibrosi cistica 230 kb 27 esoni 1480 aa proteina ABC ATP-binding cassette

39 Mutazioni CFTR e Fibrosi cistica

40

41

42

43 Test OLA (31-33 mutazioni): sensibilità del 75% f = 1/28R A = 1/28 1/28 1/4 = 1/3100 ~ Test OLA negativo 3/4 P mut+ (75%) 1/4 P mut- (25%) PORTATORE NON PORTATORE 1/2827/28 probabilità a priori 1/41 test OLA negativo 1/28 1/4 = 1/112 27/28 1 = 27/28 R A = 1/109 1/109 1/4 = 1/47500 ~ = 1/109 1/112 1/ /28

44 CFTR cDNA Esone CCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGG 477 -P--S--E--G--K--I--K--H--S--G--R--I--S--F--C--S--Q--F--S--W ATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGA 497 -I--M--P--G--T--I--K--E--N--I--I--F--G--V--S--Y--D--E--Y--R TACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAA 517 -Y--R--S--V--I--K--A--C--Q--L--E--E--D--I--S--K--F--A--E--K GACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATT 537 -D--N--I--V--L--G--E--G--G--I--T--L--S--G--G--Q--R--A--R--I- Esone 11 F508 e test OLA Oligonucleotide Ligation Assay TTTCTTTTATAGTAGAA ATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGA XXXXXXXXXXXXXXXXXXX TAATTTCTTTTATAGTA ATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGATGAATATAGA XXXXXXXXXXXXXXX Seq. wt Seq. mut

45 TTTCTTTTATAGTAGAAACCACAAAGGATACTACTT ATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGA XXXXXXXXXXXXXXXXXXX TAATTTCTTTTATAGTAACCACAAAGGATACTACTT ATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGATGAATATAGA XXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXX Reazione di Ligasi e amplificazione mediante PCR con primers specifici per le code: Pannello di prodotti di PCR di dimensioni diverse a seconda della specificità delloligonucleotide separati con elettroforesi capillare Es. F508 wt : 74 bp F508 : 70 bp

46 : diagnosi di azoospermia associata ad assenza dei vasi deferenti. Prelievo di spermatozoi e tentativi di fecondazione assistita falliti….in attesa di ICSI. Marito: CFTR D1270N-5T introne 8 Moglie: CFTR negativo per le 31 mutazioni più frequenti e analisi di 10 esoni in DGGE rischio residuo di essere portatrice: 1/200 Rischio per la coppia di avere un figlio affetto da una forma lieve di fibrosi cistica o CBAVD di 1/400

47 Mutazioni CFTR e CBAVD Sono spesso presenti (70%) segni sub-clinici di fibrosi cistica: -test al sudore alterato (> 40 mEqu/l) -ostruzione nasale, polipi nasali, sinusiti -infezioni respiratorie ricorrenti

48 Mutazioni dominanti negative proteina che non funziona e che inibisce o interferisce con la funzione della proteina normale codificata dallallele sano tipico delle proteine multimeriche Mutazioni dominanti

49 Osteogenesi imperfetta (AD) Collagene tipo I - 2 molecole di Col 1 (17q) - 1 molecola di Col 2 (7q) (338 ripetizioni GXY)

50 Osteogenesi imperfetta (AD) OI lieve (tipo I) statura normale, scarse deformità sclere blu e sordità, fratture OI letale-grave (tipo II-III) fratture multiple accorciamento delle ossa lunghe deformità ossee, sordità mut de novo in Gly 5-10% : mosaicismo germinale OI moderata (tipo IV) bassa statura, deformità osteoporosi, dentinogenesi imperfetta

51 Mutazioni che inducono un eccesso di funzione : proteina con funzione o espressione alterata es. malattia di Charcot-Marie-Tooth (17p11.2): duplicazione di 1.5 Mb di DNA (3 copie) sovraesprime la proteina della mielina periferica (PMP22) es. neoplasie endocrine multiple tipo 2 (10q11.2): mutazioni missenso del recettore RET con attivazione costitutiva ligando indipendente Mutazioni dominanti

52 Mutazioni nel FGFR3 Recettore III per fattore di crescita dei fibroblasti Fenotipi: Acondroplasia Ipocondroplasia Displasia tanatofora Acondroplasia Severa con ritardo di sviluppo e acantosi nigricans

53 Insufficienza del corredo aploide (aploinsufficienza) : la perdita di funzione di una copia del gene (50%) comporta una riduzione critica della proteina es. ipercolesterolemia: mutazioni nel recettore della lipoproteina a bassa densità (LDL) con diminuzione dei livelli di recettore ->circa il doppio di colesterolo rimane in circolo es. mutazioni RET nella malattia di Hirchsprung es. delezioni del locus PMP22 nella neuropatia tomaculare Mutazioni dominanti

54 Proteine tossiche per alcuni tessuti : Lespansione di triplette CAG nella regione codificante di alcuni geni producono lunghi tratti di poli-Glu es. Corea di Huntington e Atassie spino-cerelellari: proteine con poli-Glu che sono tossiche per le cellule nervose dei nuclei della base con formazione di inclusioni nucleari e morte cellulare

55 Malattie associate ad espansioni di triplette ripetute Le espansioni ripetute di trinucleotidi interferiscono con lespressione del gene o della proteina codificata

56 Mutazioni dominanti effetto tossico dellRNA messaggero Gene FMR1 CGG: POF - FXTAS CGG > FMR

57 Mutazioni dominanti Mutazioni germinali dominanti ma recessive a livello cellulare : Mutazioni che causano perdita di funzione di un allele conferiscono un rischio di malattia. Le cellule patologiche perdono per mutazione somatica lallele WT es. Suscettibilità al cancro da mutazioni in geni onco-soppressori.

58 Inattivazione di un allele Inattivazione di geni onco - soppressori : perdita di funzione Inattivazione del secondo allele per mutazione o delezione ( x bp x mitosi in 6x10 12 bp di genoma)

59 Gene onco-soppressore Rb1 Alleli Rb normali mutazione somatica Retinoblastoma unico mono-laterale Mutazione germinale mutazione somatica Retinoblastomi multipli bilaterali ad insorgenza precoce

60 Inattivazione di geni onco - soppressori con perdita di eterozigosità (LOH) Prima mutazione: puntiforme seconda mutazione: delezione Allele Allele Allele Allele Allele 8 Allele 2 3 6

61 Inattivazione di geni onco - soppressori con perdita di eterozigosità (LOH) Allele Allele Allele 8 Allele Loci studiati: 1234 Caso 1ni--+ Caso Caso 3++-ni Allele Allele Allele 1 8 Allele Allele Allele Allele 5 3 Allele Sede del gene onco-soppressore Tessuto sano Tessuto tumorale

62 D1S3669D1S170 SDHB exon 1 45_46insCC TTGCCGGCCCCACAACCCTTG PBL GIST PGL 50 kb telom436 kb centr


Scaricare ppt "Più generazioni interessate tramissione da parte di entrambi i sessi circa il 50% dei soggetti affetti maschi e femmine affetti non segni di consanguineità"

Presentazioni simili


Annunci Google