La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Repliconi nel DNA di Drosophila. Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006.

Presentazioni simili


Presentazione sul tema: "Repliconi nel DNA di Drosophila. Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006."— Transcript della presentazione:

1 Repliconi nel DNA di Drosophila

2 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

3

4 ---ATTTATPuTTTA TAAATAPyAAAT--- GATCTNTTNTTTTTTATNCANA 245 bp Origine di replicazione di E.coli A.R.S. di lievito Origini di replicazione di E.coli e ARS di lievito

5 L’elemento ARS di lievito

6 Controllo della replicazione Come evitare di replicare più di una volta il DNA?

7 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

8

9

10

11

12

13

14 Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche all’estremità Intervento di una proteina che si lega all’estremità Estremità di lunghezza variabile

15 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

16 AATTAGTATGTTGTAACTAAAGT TTAATCATACAACATTGATTTCA Termine forca 2 Termine forca 1 Confluenza forche GATCTNTTNTTTTTTATNCANA 245 bp Forca di replicazione 2 Forca di replicazione 1 Origine Il cromosoma di E.coli è costituito da un unico replicone bidirezionale

17 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

18

19 Replicazione di DNA circolari: il circolo rotante 5' 3'

20 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

21

22

23

24


Scaricare ppt "Repliconi nel DNA di Drosophila. Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006."

Presentazioni simili


Annunci Google