La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di.

Copie: 1
Il modello a doppia elica di Crick e Watson suggerisce un meccanismo di replicazione.

Presentazioni simili


Presentazione sul tema: "Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di."— Transcript della presentazione:

1 Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di una proteina che si lega allestremità Estremità di lunghezza variabile

2 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

3 AATTAGTATGTTGTAACTAAAGT TTAATCATACAACATTGATTTCA Termine forca 2 Termine forca 1 Confluenza forche GATCTNTTNTTTTTTATNCANA 245 bp Forca di replicazione 2 Forca di replicazione 1 Origine Il cromosoma di E.coli è costituito da un unico replicone bidirezionale

4 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

5

6 Replicazione di DNA circolari: il circolo rotante 5' 3'

7 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

8

9

10

11

12

13 Sequenze ripetute in tandem nei telomeri

14 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

15

16

17 La telomerasi estende lestremita sporgente Quando e stato sintetizzato sufficiente DNA, puo essere innescato un nuovo Frammento di Okazaki

18 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

19

20 Arthur Kornberg, 1970

21 Lattivita delle DNA polimerasi

22 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

23

24 Le tre DNA Polimerasi di E.coli Struttura Dalton Composizione Numero/cellula Attività enzimatiche Allungamento 5'-3' Esonucleasi 3'-5' Esonucleasi 5'-3' Mutanti Loci mutanti Fenotipi dei mut. Letalità 109,000 monomero 400 si polA riparazione difet. vitalità ridotta solo quando difetta 5'-3' esonucleasi >250,000 eteromultimero 10-20 si no pplC, dnaN, dnaZX, dnaQ, dbaT previene replicazione letale condizionale 120,000 monomero ? si no polB riparazione difet. senza effetto DNA Polimerasi IDNA Polimerasi IIDNA Polimerasi III

25 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

26

27 Fedeltà della replicazione Controllo presintetico Correzione di bozze

28 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

29

30

31

32

33 3 5 5 3

34

35

36


Scaricare ppt "Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di."

Presentazioni simili


Annunci Google