La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di.

Copie: 1
Il modello a doppia elica di Crick e Watson suggerisce un meccanismo di replicazione.

Presentazioni simili


Presentazione sul tema: "Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di."— Transcript della presentazione:

1 Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di una proteina che si lega allestremità Estremità di lunghezza variabile

2 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

3 AATTAGTATGTTGTAACTAAAGT TTAATCATACAACATTGATTTCA Termine forca 2 Termine forca 1 Confluenza forche GATCTNTTNTTTTTTATNCANA 245 bp Forca di replicazione 2 Forca di replicazione 1 Origine Il cromosoma di E.coli è costituito da un unico replicone bidirezionale

4 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

5

6 Replicazione di DNA circolari: il circolo rotante 5' 3'

7 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

8

9

10

11

12

13 Sequenze ripetute in tandem nei telomeri

14 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

15

16

17 La telomerasi estende lestremita sporgente Quando e stato sintetizzato sufficiente DNA, puo essere innescato un nuovo Frammento di Okazaki

18 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

19

20 Arthur Kornberg, 1970

21 Lattivita delle DNA polimerasi

22 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

23

24 Le tre DNA Polimerasi di E.coli Struttura Dalton Composizione Numero/cellula Attività enzimatiche Allungamento 5'-3' Esonucleasi 3'-5' Esonucleasi 5'-3' Mutanti Loci mutanti Fenotipi dei mut. Letalità 109,000 monomero 400 si polA riparazione difet. vitalità ridotta solo quando difetta 5'-3' esonucleasi >250,000 eteromultimero si no pplC, dnaN, dnaZX, dnaQ, dbaT previene replicazione letale condizionale 120,000 monomero ? si no polB riparazione difet. senza effetto DNA Polimerasi IDNA Polimerasi IIDNA Polimerasi III

25 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

26

27 Fedeltà della replicazione Controllo presintetico Correzione di bozze

28 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

29

30

31

32

33

34

35

36


Scaricare ppt "Replicazione delle estremità Replicone circolare Il replicone lineare può essere convertito in circolare Strutture specifiche allestremità Intervento di."

Presentazioni simili


Annunci Google