La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore


Presentazioni simili




3 REGOLAZIONE DELL’ESPRESSIONE GENICA ESPRESSIONE DEL GENOMA UMANO NELLE CELLULE DIFFERENZIATE 1.Tutte le cellule di un organismo hanno lo stesso corredo genomico (~40000 geni) 2.L’espressione genica tessuto specifica determina il fenotipo morfo-funzionale dei tipi cellulari e tissutali 3.In ogni cellula differenziata ed in ogni particolare momento dello sviluppo e’ attivo solo un sottoinsieme di geni

4 Restrizione spaziale e temporale dell’espressione genica  Geni housekeeping  Geni con espressione ristretta nello spazio Espressione in piu’ organi/tessuti diversi Stesso ruolo in piu’ tessuti Il gene codifica per diverse isoforme (promotori alternativi e/o splicing alternativo tessuto specifico) Espressione specifica per tessuto, linea o tipo cellulare Espressione solo in singole cellule Distribuzione intracellulare o extracellulare  Geni con espressione ristretta nel tempo  Stadio di sviluppo  Stadio di differenziamento  Momento del ciclo cellulare  Espressione inducibile da parte di fattori ambientali o extracellulari REGOLAZIONE DELL’ESPRESSIONE GENICA


6 INIZIO DELLA TRASCRIZIONE La RNA polimerasi riconosce l’inizio del gene. Viene diretta sul TSS (Transcription Start Site) sulla base della sua affinita’ per la specifica sequenza upstream al gene, ovvero il promotore. La doppia elica viene aperta dove inizia la sintesi del messaggero. 2 steps 1.I TF legano la sequenza promotrice (e gli enhancers) formando un complesso multiproteico 2.Il complesso recluta la pol II complessata ad alcuni GTF e questa si lega al promotore core REGOLAZIONE DELL’ESPRESSIONE GENICA Puo’ agire su ciascuno dei livelli che caratterizzano il passare dell’informazione genica dal DNA alle proteine Negli Eucarioti superiori si svolge pricipalmente come controllo della trascrizione

7 REGOLAZIONE DELL’ESPRESSIONE GENICA POL II PROMOTER ELEMENTS TSS (vicino alla regione Initiator) + sito di legame per un GTF (spesso TBP) CORE PROMOTER ELEMENTS TATA box Initiator Downstream promoter element TRANSCRIPTION FACTORS (TF) BINDING SITES CAAT box GC box Sp-1 sites GAGA boxes ENHANCER(S) SITES

8 REGOLAZIONE DELL’ESPRESSIONE GENICA Assemblaggio del complesso attivatore della trascrizione sul promotore prossimale e sulla regione core

9 Struttura schematica di un promotore per la Pol II PROMOTORE CORE  regione sufficiente a deteminare il TSS esatto PROM. PROSSIMALE  bp upstream al TSS, responsabile, almeno in parte, della modulazione dell’espressione PROMOTORE DISTALE  100 bp – 2 Mb

10 4 possibili assetti di promotori core funzionali A C BD CORE PROMOTER MODULE GENERAL

11 caaaacggttgacaacatga agtaaacacggtacgatgtaccacat aaagagtattgacttaaagt ctaacctataggatacttacagccat tggcggtgttgacataaata ccactggcggtgatactgagcacatc cgtgcgtgttgactatttta cctctggcggtgataatggttgcatg tgccgaagttgagtattttt gctgtatttgtcataatgactcctgt tctttttgatgcaattcgct ttgcttctgactataatagacagggt cattaacgtttacaatttaa atatttgcttatacaatcatcctgtt cgtcaggattgacaccctcc caattgtatgttttcatgcctccaaa aattgttgttgttaacttgt ttattgcagcttataatggttacaaa atgagctgttgacaattaat catcgaactagttaactagtacgcaa tgttgacaattt t t t tg tataatg c t Due regioni in cui la sequenza e’ conservata: dallo start site (motivi TTGACA e TATAAT) IL TFIID e’ un complesso della TATA box binding protein (TBP) e di altre proteine chiamate TATA binding protein associated factors, o TAFs. L’inizio della transcrizione puo’ essere studiato in vitro (DNA + proteine purificate). L’inizio della trascrizione da promotori TATA-containing non richiede necessariamente TAFs. TAFs stimulate initiation from TATA-containing promoters that also have Inr's. TAFs are required for initiation from TATA-less promoters. Sequenze nucleotidiche al 5’ del sito d’inizio della trascrizione di geni di E.coli trascritti attraverso il fattore housekeeping sigma70 della RNA polimerasi

12 I motivi TTGACA and TATAAT sono i segnali che vengono riconosciuti dalla subunita’ sigma70 della polimerasi. La “forza” relativa di un promotore e’ proporzionale alla sua similarita’ ad una specifica sequenza consenso. Mutazioni nelle regioni -10 and –35 alterano la “forza” del promotore. Esperimenti tipo footprinting o methylation interference confermano la loro attivita’. CONSENSUS SEQUENCE APPROACH TO THE IDENTIFICATION OF GENETIC SIGNALS

13 GENETIC SIGNALS dobefmolecdaiularsqueihgensvweticskiprovsvillmmdescheplemolasusyretpb Gli ELEMENTI SEGNALE generalmente agiscono solo sulle molecole di DNA di cui fanno parte ("cis-acting elements“) Questi elementi segnale vengono “accesi” o “spenti” attraverso l’interazione con fattori di trascrizione I fattori di trascrizione sono PROTEINE. In generale, sono proteine in grado di diffondere nelle cellule e in grado di interagire con elementi bersaglio che possono trovarsi in una qualsiasi molecola di DNA (“trans-acting factors”) dobefmolecdaiularsqueihgensvweticskiprovsvillmmdescheplemolasusyretpb molec ular gen etics pro vi des ple asu re


15 muscle-type creatine kinase (-1091 –1062)... ggaggagaagctcgctCTAAAAATAAccct... alpha-myosin heavy chain ( )... cagaTTAAAAATAActaa... myogenin (-131 –15)... gcagccggacaagttttgatgcgaggcagcagcttagggtgggct aggtttcctttaggttttctatatttatctctgtgatttaatgccagcgccgg ggtttaaatggcaccgag Evidenze: DNase I footprinting, direct gel shift, supershift (antibody binding) e methylation protection DATI NOTI: SEQUENZE REGOLATIVE IN GRADO DI LEGARE MEF-2 UPSTREAM AD ALCUNI GENI REGOLATI DA MEF-2







22 MODELLO DI ORGANIZZAZIONE DI UN PROMOTORE COMPLESSO RANTES/CCL5 - chemokine – inflammation Promoter characterized


24 Sono disponibili le sequenze di molti genomi interi Per diversi organismi procariotici ed eucariotici virtualmente tutti i geni sono noti o predetti Informazioni funzionali ancora parziali:  regolazione espressione genica  funzione proteine L’analisi di singoli promotori con i metodi tradizionali e’ molto lenta e dispendiosa, non “scaled up” alla quantita’ di dati disponibili Applicazione di metodi di “PATTERN DISCOVERY” allo studio di sequenze regolative PATTERN DISCOVERY IN SEQUENZE PROMOTORIALI PER LA RICERCA DI NUOVI ELEMENTI FUNZIONALI

25 Perche’ si possono applicare metodi di “PATTERN DISCOVERY” allo studio di sequenze regolative di geni ? E’ verosimile che: sottogruppi simili di fattori di trascrizione gruppi di geni espressi in modo simile (nel tempo, nello spazio) co-regolati ovvero che siano controllati da sottogruppi simili di fattori di trascrizione condividano almeno parte degli elementi regolativi cis-acting, cioe’ i segnali nelle sequenze promotoriali Pattern discovery  scoprire sottostringhe comuni tra piu’ stringhe (es. Sequenze di DNA) Problemi: I “segnali genetici” non sono pattern esatti ma approssimati Possono esserci o non esserci nelle sequenze analizzate PATTERN DISCOVERY IN SEQUENZE PROMOTORIALI PER LA RICERCA DI NUOVI ELEMENTI FUNZIONALI

26 PATTERN MATCHING/RECOGNITION vs PATTERN DISCOVERY PATTERN MATCHING  trovare TUTTE le volte in cui uno specifico PATTERN esatto si presenta (occurences) in una stringa o in un insieme di stringhe (sequenze di DNA o aminoacidi) Es.: trovare il PATTERN “HHKHKK” in AMVOIBGJFDHHKHKKUUUPFIRJRNTMDHHKHKKHJHKKSAAW PATTERN RECOGNITION  riconoscere le occurences approssimate di uno specifico PATTERN in una una stringa o in un insieme di stringhe Es.: trovare il PATTERN “HH*HKK” in AMVOIBGJFDHHKHKKUUUPFIRJRNTMDHHAHKKHJHKKSAAW


28 Approaches to pattern recognition Quali siti potenzialmente leganti fattori di trascrizione si trovano sulla mia sequenza e dove sono localizzati ? Query: 250 bp upstream al gene per un canale Na + /Ca ++ espresso nel muscolo e nel tessuto nervoso

29 Approaches to pattern recognition Quali siti potenzialmente leganti fattori di trascrizione si trovano sulla mia sequenza e dove sono localizzati ? Tabella dei risultati Sp1



32 Pattern driven:  Enumerazione di tutti (o alcuni) dei possibili patterns fino a una certa lunghezza, per ciascun pattern si calcola un punteggio basato sulla frequenza e si scelgono i punteggi piu’ alti Non fattibile per pattern anche di dimensione modesta Sequence driven:  Ricerca dei pattern basata sull’allineamento delle sequenze Approaches to pattern discovery

33 I metodi "pattern driven" cercano in una sequenza specifiche classi di pattern e valutano la loro frequenza di apparizione. Il numero di pattern possibili aumenta esponenzialmente con la lunghezza dell'input. Per pattern esatti, ad esempio, e' quadratico. L'utilizzo di una struttura di dati ad albero dei suffissi migliora l'efficienza del metodo e permette di trovare tutte le sequenze piu' (o meno) rappresentate dell'atteso in tempo lineare con la dimensione dell'input Algoritmi pattern driven

34 Il problema e’ trovare pattern significativi, tra tutti i possibili pattern. I pattern sono sottostringhe. Considero tutti i possibili pattern lunghi 10 nucleotidi nella seguente sottostringa: AGTCTTGTGCTTTTAGTCTTGTGCCTAGTCTCTAATTTAGACAGTCT AGTCTTGTGC GTCTTGTGCT TCTTGTGCTT CTTGTGCTTTT TTGTGCTTTTA TGTGCTTTTAG GTGCTTTTAGT TGCTTTTAGTC GCTTTTAGTCT CTTTTAGTCTT TTTTAGTCTTG TTTAGTCTTGT TTAGTCTTGTG TAGTCTTGTGC AGTCTTGTGCC GTCTTGTGCCT... Sono rappresentati tutti 1 volta, mentre la sottostringa AGTCTTGTGCC e’ rappresentata 2 volte. Voglio sapere se trovare una sottostringa lunga 10 rappresentata 2 volte e’ SORPRENDENTE.

35 Per calcolare quanto un fenomeno sia sorprendente ci si riferisce a quello che ci si aspetta, sotto un’ipotesi probabilistica. La frequenza attesa di una sottostringa dipende dalla composizione della stringa. se %G=%C=%A=%T=25% posso immaginare una sorgente casuale che crea delle stringhe in modo che la probabilita’ di osservare un certo nucleotide in una certa posizione e’ indipendente dalla sequenza precedentemente generata (Modello di Bernoulli) A ATGCTGT T sempre 25% G C Approccio enumerativo:  enumerare tutti i possibili pattern di una certa lunghezza contenuti in una stringa  calcolare la significativita’ statistica di ciascuno  prendere in considerazione i pattern piu’ significativi Pero’ esistono 4 10 (1,048,574) possibili pattern lunghi 10 in un alfabeto di 4 nucleotidi Algoritmi pattern driven

36 Poiche’ il problema e’ computazionalmente complesso, sono stati introdotti approcci euristici per limitare il “search space”:  si cerca solo un sottogruppo di pattern and esempio imponendo restrizioni sulla posizione dei “mismatches”  si usano particolari strutture-dati che facilitano la ricerca Un Suffix Tree e’ una struttura-dati che permette di risolvere “agevolmente”molti problemi con le stringhe tree substrings tree-->|---mississippi m.. mississippi | |---i-->|---ssi-->|---ssippi i.. ississippi | | | | | |---ppi issip,issipp,issippi | | | |---ppi ip, ipp, ippi | |---s-->|---si-->|---ssippi s.. ssissippi | | | | | |---ppi ssip, ssipp, ssippi | | | |---i-->|---ssippi si.. sissippi | | | |---ppi sip, sipp, sippi | |---p-->|---pi p, pp, ppi | |---i p, pi

37 Algoritmi pattern driven ANALYSIS OF MULTIPLE SEQUENCES: trova le parole sopra- o sotto-rappresentate in un gruppo di sequenze ANALYSIS OF MULTIPLE SEQUENCES: Enumera tutti i possibili pattern che ricorrono in almeno q sequenze, con em mutazioni, se m e’ la lunghezza del pattern

38 Si basano su: 1.Raggruppamento di sequenze simili o “funzionalmente equivalenti” 2.Per ogni gruppo, ricerca di pattern comuni tra le sequenze 3.Raggruppamento di pattern simili e ripetizione dello step precedente fino a che rimane un solo gruppo I metodi "sequence driven" lavorano combinando i risultati della comparazione a coppie di sequenze, con il fine di evidenziare le regioni simili. Il problema di enumerare tutti i possibili pattern con occorrenze non esatte e' piuttosto impegnativo, percio' molti programmi cercano soluzioni "quasi ottimali" attraverso algoritmi euristici. Algoritmi sequence driven




42 Cerca "parole" non-degenerate, sovrarappresentate in un gruppo di sequenze (positive set) rispetto ad un gruppo di controllo (negative set)


44 IL “CHALLENGE PROBLEM” Trovare un segnale lungo 15 nucleotidi con 4 wildcards (15-4) In 20 sequenze tutte conteneti un’istanza del segnale stesso. Performances dei diversi programmi: Sostanzialmente una frazione molto piccola dei segnali viene ritrovata e questa frazione tende a zero non appena la lunghezza delle sequenze in analisi supera il centinaio di basi

45 COMPLESSITA’ REALE DEL PROBLEMA: La lunghezza delle sequenze promotoriali varia da 300 a 2000 paia di basi a seconda del gene e del fatto che si consideri il promotore core, quello prossimale o anche quello distale. I segnali non sono pattern esatti. Non tutti i promotori di geni presumibilmente coregolati contengono il medesimo segnale. ANALISI SU LARGA SCALA DELLE MATRICI DI TRANSFAC UTILIZZO DI SIMULAZIONI MASCHERAMENTO DELLE SEQUENZE ??? E’ NECESSARIO FARE RICORSO ALLE CONOSCENZE BIOLOGICHE PER FILTRARE L’INPUT E L’OUTPUT DI PROGRAMMI DI PATTERN DISCOVERY:

46 Analisi sistematica di regioni upstream a geni di lievito per cercare di scoprire “regular expression-type patterns” ed identificare nuovi elementi regolativi presunti Nuovo algoritmo di pattern discovery che cerca in modo esaustivo pattern sconosciuti a priori che siano piu’ rappresentati nelle sequenze upstream a geni che in un insieme di sequenze extrageniche di lievito, prese come campione di riferimento Data set: >6000 sequenze upstream a geni di lievito Metodo: cercano i pattern che si trovano piu’ frequentemente nelle regioni upstream a geni che non nel resto del genoma numero di seq. upstr. che contengono il pattern Punteggio= numero di sequenze random che lo contengono Risultati: tra i pattern con i punteggi piu’ alti molti sono simili a sequenze note per legare fattori di trascrizione di lievito “Predicting gene regulatory elements in silico on a genomic scale” BRAZMA et al. 1998, Genome Research


Presentazioni simili

Annunci Google