La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

C). Chimica del DNA i). Forze che influenzano la stabilità della doppia elica del DNA interazioni idrofobiche - stabilizzano dentro idrofobiche e fuori.

Presentazioni simili


Presentazione sul tema: "C). Chimica del DNA i). Forze che influenzano la stabilità della doppia elica del DNA interazioni idrofobiche - stabilizzano dentro idrofobiche e fuori."— Transcript della presentazione:

1 c). Chimica del DNA i). Forze che influenzano la stabilità della doppia elica del DNA interazioni idrofobiche - stabilizzano dentro idrofobiche e fuori idrofiliche relativamente deboli ma aggiuntive forze di Van de Waals legami idrofobi – stabilizzano legami idrogeno - stabilizzano relativamente deboli ma aggiungono e facilitano impilamento interazioni elettrostatiche - destabilizzano contribuiti primariamente dai fosfati (negativi) interessano interazioni intrafilamento e interfilamento repulsione può essere neutralizzata da cariche positive (es, ioni Na + o proteine cariche positivamente) 1

2 Regione del core idrofobica Fosfati idrofobici Fosfati idrofilici 2

3 Interactions Sovrapposte Cariche di repulsione Cariche repulsione 3

4 Le nucleasi idrolizzano i legami fosfodiesterei Endonucleasi tagliano interna mente e possono tagliare su entrambi i lati del fosfato lasciando estremità 5 fosfato o 3 fosfato in dipendenza del- la particolare endonucleasi. Esonucleasi tagliano i nucleotidi terminali es, esonucleasi proofreading es, endonucleasi restrizione 4

5 5

6 ii). Denaturazione del DNA DNA a doppio-filamento Regioni ricche A-T denaturano prima Svolgimento cooperativo dei filamenti del DNA Separazione dei filamenti e formazione di un singolo-filamento avvolto a caso pH estremi o alte temperature 6

7 7

8 Micrografia elettronica di DNA parzialmente fuso regioni ricche in A-T fondono prima, seguite da regioni ricche in G-C DNA a doppio-filamento, ricco in G-C che non è ancora fuso Regioni di DNA ricche A-T fondono (si separano) in una bolla a singolo- filamento 8

9 Ipercromicità Lassorbanza a 260 nm di una soluzione di DNA aumenta quando la doppia elica è separata in singoli filamenti. 260 Assorbanza Singolo-filamento Doppio-filamento

10 10

11 11

12 12

13 DNA riassociazione (rinaturazione) DNA a doppio-filamento Denaturazione, DNA a singolo-filamento Lenta, processo di secondo-ordine a velocità limitante, per trovare sequenze di basi complementari k2k2 Più veloce, reazione zippering per formare lunghe molecole di DNA a doppio filamento a). Complessità del DNA cromosomico 13

14 Cinetiche di riassociazione di DNA (per una singola specie di DNA) C o t 1/2 = 1 / k 2 k 2 = constante di velocità di secondo-ordine C o =concentrazione di DNA t 1/2 = tempo di metà reazione C o t 1/ % DNA riassociato log C o t Ideale curva (curva Cot) di riassociazione di DNA di secondo-ordine A metà della reazione (cioè a t ½) il 50% è riassociato Questo punto è il Cot al t ½ cioè quelle condizioni che danno metà della totale rinaturazione 14

15 k 2 >>>>>>>>>> k ,000 15

16 Complessità espressa come coppie di basi (bp) CotCot = poly(dT)-poly(dA) 2 = DNA satellite umano purificato 3 = DNA batteriofago T4 4 = DNA genomico di E. coli 5 = DNA umano a singola-copia purificato C o t 1/2 Cè una relazione diretta tra C o t 1/2 e la complessità

17 Tipo di DNA % of Genoma Caratteristiche Singola-copia (unica) Include la maggior parte dei geni 1 Disseminato attraverso il genoma tra e Ripetitivo (intersparso) entro i geni; include sequenze Alu 2 e VNTRs o mini (micro) satelliti Satellite (tandem) Altamente ripetuto, sequenze a bassa complessità di solito localizzate nei centromeri e telomeri 2 Le sequenze Alu sono circa 300 bp in lunghezza e sono ripetute circa 300,000 volte nel genoma. Esse possono trovarsi negli introni, adiacenti o entro i geni, o in regioni non tradotte. 1 Alcuni geni sono ripetuti da poche a migliaia di volte e così sono presenti nella frazione di DNA ripetitivo I I I I I I I I I veloce intermedio lento (singola-copia) 17

18 C o t 1/2 Cinetiche di riassociazione di DNA da una miscela di specie di DNA C o t 1/2 = 1 / k 2 k 2 = constante di velocità di secondo-ordine C o = concentrazione DNA t 1/2 = tempo di metà reazione % DNA riassociato I I I I I I I I I log C o t veloce (ripetute) intermedia (ripetute) lenta (singola-copia) DNA genomico umano Frazioni cinetiche : veloce intermedia lenta C o t 1/2 18

19 Classi di DNA ripetitivo Ripetizioni Intersparse (disperse) (e.g., Alu sequences) TTAGGGTTAGGGTTAGGGTTAGGG Ripetizioni Tandem (e.g., microsatelliti) GCTGAGG 19

20 Proprietà del genoma umano Nucleare il genoma umano aploide ha ~3 X 10 9 bp di DNA DNA a singola-copia comprende ~75% del genoma umano il genoma umano contiene ~30,000 a 40,000 geni la maggior parte dei geni sono a singola-copia nel genoma aploide i geni sono composti da 1 a >75 esoni i geni variano in lunghezza da 2,300,000 bp le sequenze Alu sono presenti attraverso il genoma Mitocondriale genoma circolare di ~17,000 bp contiene <40 geni 20

21 53 promoter region esoni (regioni nel box riempite e nonriempite) introni (tra gli esoni) regioni tradotte regione tradotta mRNA structure +1 b). Struttura del Gene 21

22 (esone-introne-esone) n struttura di diversi geni -globina HGPRT (HPRT) ipoxantina-guanina totale = 1,660 bp; 3 esoni = 990 bp; 2 introni istone factor VIII totale = 400 bp; 1 solo esone = 400 bp totale = 42,830 bp; 9 esoni = 1263 bp totale = ~186,000 bp; molti esoni = ~9,000 bp 22

23 Familial hypercholesterolemia autosomal dominant LDL receptor deficiency 23

24 Gene del recettore LDL Ripetizioni Alu presenti entro gli introni Ripetizioni Alu in esoni Alu X 4 6 crossing over ineguale 1 prodotto ha un esone 5 deleto (laltro prodotto non è mostrato) 24

25 25

26 Struttura genoma umano Si divide in: 25% GENICO 50% sequenze ripetute 5% Segmenti Duplicati 75% INTRAGENICO 45% ripetizioni intersperse 25% DNA spaziatore 1,5% quello che esprime 23,5% introni e pseudogeni Sequenza di nucleotidi simile a un gene ma non in grado di produrre proteine funzionali 26

27 Nel genoma umano le sequenze ripetute costituiscono almeno il 50% del totale e sono suddivise in 5 classi: sequenze ripetute derivate da trasposoni (intersperse) copie inattive di geni ripetizioni di sequenze semplici (minisatelliti e microsatelliti): (A)n, (CA)n, (CGG)n duplicazioni segmentali sequenze ripetute in tandem (centromeri, telomeri, cluster ribosomali) Il 45% delle ripetizioni intersperse è dato da trasposoni e retrotrasposoni. I trasposoni sono elementi ripetuti in grado di muoversi nel genoma, costituiti tra le 80 e le paia di basi Le differenze tra queste due classi risiedono nella differente modalità di inserimento della molecola di DNA: il trasposone copia gli elementi direttamente in DNA,il retrotrasposone utilizza come intermedio una molecola di RNA convertendola in DNA (questo processo, cioè il passaggio da una molecola di RNA ad una di DNA, nel 1975 non sembrava possibile). I RETROTRASPOSONI si dividono in NON VIRALI LINE S(Long Interdispersed Elements (6-7 kb) SINES ( Short Interdispersed Elements ( bp) ES. Alu VIRALI RIPETIZIONI LTR (Long Terminal Repeats) Le ripetizioni LTR dei retroasposoni virali sono sequenze ripetute che permettono lo spostamento della molecola di DNA mobile, e rappresentano le porzioni terminali sia destra che sinistra della molecola. 27

28 28

29 29

30 30

31 31

32 32


Scaricare ppt "C). Chimica del DNA i). Forze che influenzano la stabilità della doppia elica del DNA interazioni idrofobiche - stabilizzano dentro idrofobiche e fuori."

Presentazioni simili


Annunci Google