La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Le Pierangiolate n.2 Dipartimento di Ingegneria della Informazione e Scienze Matematiche Luca Chiantini presenta Se gratti S I E N A Che cosa salta fuori?

Presentazioni simili


Presentazione sul tema: "Le Pierangiolate n.2 Dipartimento di Ingegneria della Informazione e Scienze Matematiche Luca Chiantini presenta Se gratti S I E N A Che cosa salta fuori?"— Transcript della presentazione:

1 Le Pierangiolate n.2 Dipartimento di Ingegneria della Informazione e Scienze Matematiche Luca Chiantini presenta Se gratti S I E N A Che cosa salta fuori?

2 Se gratti S I E N A Che cosa salta fuori? Giochi di Archimede novembre 2006 PROBLEMA : In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive?

3 In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive? E S AIN SNAI E SNAIE ok no cosa scommettere?

4 In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive? Tirare a indovinare Forza bruta Metodo matematico MENONE: Differenza fra retta opinione e Scienza Platone

5 In quanti modi diversi si possono ordinare le lettere della parola SIENA? Forza bruta ESAIN S ha 5 possibilità I ha 4 possibilità E ha 3 possibilità N ha 2 possibilità A ha 1 possibilità ! = = 120 fattoriale SIENA

6 S nella prima casella Per avere due consonanti vicine N nella seconda casella Possibilità = 6 S nella terza casella Possibilità = 12 N nella seconda o quarta casella S nella seconda casella N nella prima o terza casella Possibilità = 12 S nella quarta casella N nella terza o prima casella Possibilità = 12 S nella quinta casella N nella quarta casella Possibilità = 6 48 In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive? = 120 – 48 = 72

7 In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive? = 120 – 48 = 72 Probabilità di successo = 72 / 120 = 3 / 5 = 60% Ragionamento per analogia Avessi la parola L I C E O? Se invece di S I E N A 72 Avessi la parola P A L I O? 72 Avessi la parola C I E L O?72 Qualunque parola di 5 lettere con 2 consonanti e 3 vocali dà la stessa soluzione

8 nel P A L I O si pongono numerosissimi problemi combinatorici simili ESEMPIO: se in un Palio corrono solo due contrade nemiche, quale è la probabilità che finiscano accanto al canape? ESEMPIO: quante sono le possibilità di allineamento alla mossa? 20% 17! / 7! = … 8 =

9 Avessi la parola P A L C O?sono 12 (10%) In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive? = 120 – 48 = 72 Probabilità di successo = 72 / 120 = 3 / 5 = 60% Ragionamento per analogia Avessi la parola L I C E O? Se invece di S I E N A 72 Avessi la parola P A L I O? 72

10 Qualunque parola di 5 lettere con 2 consonanti e 3 vocali DISTINTE dà la stessa soluzione Avessi la parola L I C E I ? Se invece di L I C E O In quanti modi diversi si possono ordinare le lettere della parola LICEI? L I C E OL I C E I L O C E IL I C E I idem come sopra Quindi le possibilità si dimezzano, in quanto uno scambio delle due I non modifica la parola 120 / 2 = 60 possibilità

11 In quanti modi diversi si possono ordinare le lettere della parola LICEI? Stesso discorso vale per le disposizioni in cui le due consonanti non sono contigue: poiché scambiando le I la parola non cambia il loro numero si dimezza 120 / 2 = 60 possibilità 72 / 2 = 36 possibilità senza consonanti contigue In quanti modi diversi si possono ordinare le lettere della parola LICEI, in modo che non vi siano due consonanti contigue? = 36 I numeri cambiano, ma la percentuale no! 36 / 60 = 3 / 5 = 60%

12 120 / 4 = 30 possibilità totali 72 / 4 = 18 possibilità senza consonanti contigue In quanti modi diversi si possono ordinare le lettere della parola ARARE, in modo che non vi siano due consonanti consecutive? I numeri cambiano, ma la percentuale no! 18 / 30 = 3 / 5 = 60% Stavolta, oltre a poter scambiare le due A, possiamo anche scambiare le due R senza cambiare la parola

13 Stavolta, oltre a poter scambiare le due N, possiamo anche permutare le tre A senza cambiare la parola 120 / (2 6) = 10 possibilità totali 72 / (2 6) = 6 possibilità senza consonanti contigue In quanti modi diversi si possono ordinare le lettere della parola ANANA, in modo che non vi siano due consonanti consecutive? I numeri cambiano, ma la percentuale no! 6 / 10 = 3 / 5 = 60% ci sono 6 permutazioni sulle A AAANNANNAA AANANNAAAN AANNANAANA ANAANNANAA ANANANNAAA ci sono 2 permutazioni sulle N

14 AAANNANNAA AANANNAAAN AANNANAANA ANAANNANAA ANANANNAAA Le precedenti parole possono essere considerate SCHEMI di situazioni, in cui A = vocale N = consonante ORDINAMENTO LESSICOGRAFICO Ogni parola di cinque lettere con due consonanti può essere ridotta a uno degli schemi precedenti L I C E O S I E N A A R A R E N A N A A N A A N A A N A N A Problemi combinatorici di questo tipo si studiano partendo dalla comprensione di ciò che avviene sugli schemi.

15 ESEMPIO: se in un Palio corrono solo due contrade nemiche, quale è la probabilità che finiscano accanto al canape? 20% E' sufficiente lavorare sugli schemi di parole con 10 lettere del tipo AANANAAAAA, dove N = contrada con nemica A = contrada senza nemica Il numero totale di tali schemi è: 10! / (2! 8!) permutazioni delle Npermutazioni delle A = (10 9) / 2 = 45

16 ESEMPIO: se in un Palio corrono solo due contrade nemiche, quale è la probabilità che finiscano accanto al canape? Affichè le due nemiche si trovino accanto: Il numero totale di tali schemi è 45 9 / 45 = 20% se la prima N è al primo postola seconda N deve essere al posto 2 se la prima N è al posto 2la seconda N deve essere al posto ci sono 9 posti dove si può trovare la prima N quindi ci sono 9 schemi in cui le due nemiche sono affiancate ANNAAAAAAAAAA

17 GENERALIZZANDO: Disponendo n oggetti, di cui due di tipo N e i rimanenti di tipo A, quale è la probabilità che i due oggetti di tipo N finiscano accanto? Il numero totale degli schemi è ci sono n-1 schemi in cui le due N sono affiancate n! / (2! (n-2)!) = n (n-1) / 2 PROBABILITA' =(n-1) 2 / n (n-1) = 2 / n PROBLEMA SCHEMATIZZAZIONE GENERALIZZAZIONE APPLICAZIONI analogia

18 "poesia della Matematica" ITALO CALVINO nato a Cuba 1923 morto a Siena 1985 Le città invisibili (1972) MARCO Di una città non godi le sette, o le settantasette meraviglie, ma la risposta che dà ad una tua domanda KAN O le domande che ti pone, costringendoti a rispondere. Come Tebe, per bocca della Sfinge.

19 Prendendo a caso una QUALUNQUE parola di 5 lettere, quale è la probabilità di trovare due consonanti consecutive? Gli SCHEMI di parole con 5 vocali sono Gli SCHEMI di parole con 4 vocali sono Gli SCHEMI di parole con 3 vocali sono Gli SCHEMI di parole con 2 vocali sono Gli SCHEMI di parole con 1 vocale sono Gli SCHEMI di parole con 0 vocali sono Triangolo di Tartaglia (A + N)^5 = (A + N) (A + N) (A + N) (A + N) (A + N) (A + N) = …… Di cui "buoni" probabilità 19 / 32 = 59% circa SIMMETRIA = 2 5

20 Prendendo a caso una QUALUNQUE parola di n lettere, quale è la probabilità di trovare due consonanti consecutive? Gli SCHEMI di parole con n vocali sono Gli SCHEMI di parole con n-1 vocali sono Gli SCHEMI di parole con 0 vocali sono 1 n 1 Triangolo di Tartaglia Di cui buoni ? 2n2n ………………. buon divertimento...

21 ESEMPIO: e se ci sono DUE coppie di contrade nemiche, quale è la probabilità che ALMENO una coppia finisca accanto? unaltra coppia accanto una coppia accanto + 20% 40% conteremmo 2 volte una disposizione in cui entrambe le coppie di nemiche sono accanto PERCENTUALE GIUSTA % due nemiche accanto = +- % entrambe le coppie di nemiche sono accanto (FORMULA di GRASSMANN)

22 PERCENTUALE GIUSTA % due nemiche accanto =+ - % entrambe le coppie di nemiche sono accanto % due nemiche accanto quante sono le disposizioni in cui entrambe le coppie di nemiche sono accanto? se le prime due nemiche finiscono in queste posizioni (2 8! possibilità ) allora le altre due nemiche devono stare: accanto nelle prime tre posizioni accanto nelle ultime cinque posizioni ( ) 6! possibilità ( ) 6! possibilità è il ragionamento di prima, adattato al caso di tre o cinque posizioni al canape

23 PERCENTUALE GIUSTA % due nemiche accanto = +- % entrambe le coppie di nemiche sono accanto % due nemiche accanto il ragionamento va ripetuto per tutte le possibili disposizioni delle prime due nemiche cioè per tutte le PARTIZIONI binarie di 8 (= 10 – 2): 8 = = = =.... RISULTATO FINALE = % entrambe le coppie di nemiche sono accanto quindi Se ci sono DUE coppie di contrade nemiche, quale è la probabilità che ALMENO una coppia finisca accanto? 2 / 45 35,55...%

24 ESEMPIO: e se ci sono TRE coppie di contrade nemiche, quale è la probabilità che ALMENO una coppia finisca accanto? stavolta arriveremo a dover considerare le partizioni TERNARIE di 6 ad esempio 6 = buon divertimento! IN GENERALE è difficile trovare una funzione F(n) che in base a quante coppie n di nemiche ci sono mi dà la probabilità che almeno due nemiche siano accanto al canape. eccetera... YOUNG TABLEAUX funzione generatrice

25 P R O B A B I L I T A Casi favorevoli Casi possibili ? Esce 1 Esce 2 Esce 3 Esce 4 Esce 5 Esce 6 Esce 3 Non esce 3 Truccato? Prendendo a caso una QUALUNQUE parola di 5 lettere DEL VOCABOLARIO, la probabilità di trovare due consonanti consecutive NON è certo il 59%! La probabilità non è più di 1/6

26 Presso tali popoli, lo studio della combinatorica fa parte del Le password dei programmi non vanno mai, preferibilmente, cercate fra le parole di senso compiuto Pensate che stiamo scherzando? Usando le distorsioni causate da elementi linguistici, si possono krakkare i codici segreti Alan Turing Presso alcuni popoli e alcune culture, il rimescolamento combinatorico degli elementi è la via fondamentale per il raggiungimento della conoscenza mistica DNA culturale?

27 La catena del DNA rappresenta una sequenza di proteine di 4 tipi: A C G T DNA Il codice del DNA è compreso solo parzialmente buona parte dellanalisi del DNA è di tipo combinatorico …ACATCGGACCTGACACGTAGTCAGTATCAGACTCCGAACT… Studiando le occorrenze non casuali, si possono ottenere informazioni su come sono codificate le informazioni per la costruzione degli esseri viventi

28 SPONSORS Fondazione Monte dei Paschi di Siena Wind Novartis Italia Siena Biotech SienaBioGrafix ProteoGenBio Centro Sviluppo Diesse Diagnostica Senese S.p.A. MASTER in BIOINFORMATICA A. del Lungo CORSO di LAUREA MAGISTRALE in BIOINFORMATICA congiunto Università di SIENAUniversità di LEIDA (NL)

29 Le città invisibili (1972)... Il Kan cercava di immedesimarsi nel gioco, ma ora era il perchè del gioco a sfuggirgli. Quale era la posta? Allo scacco matto, sotto il piede del re sbalzato dal vincitore, non rimaneva che una casella vuota, un tassello di legno piallato: il nulla... Allora Marco parlò – La tua scacchiera, Sire, è intarsio di due legni: ebano e acero. Il tassello sul quale si fissa il tuo sguardo illuminato fu tagliato su uno strato del tronco che crebbe in un anno di siccità: vedi infatti come sono strette le fibre? Ecco un poro più grosso, indice di una malattia della pianta, che forse portò al suo abbattimento... – e continuava. Il Kan era stupito. La quantità di cose che si potevano leggere su un pezzetto di legno piallato lo sommergeva. E già Marco era venuto a parlare dei boschi di ebano, di zattere sui fiumi, e di approdi, e di donne alle finestre...

30 ESAIN In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive?

31 ESAIN In quanti modi diversi si possono ordinare le lettere della parola SIENA, In modo che non vi siano due consonanti consecutive? Le possibili disposizioni sono ancora 120 Ho 5 possibilità per la S. Ovunque metta la S, ho poi 2 possibilità per la N. Poi ho 3 · 2 · 1 possibilità per le vocali Per avere due consonanti accanto: 60 possibilità su 120: il 50%!

32 Naturalmente il pentagono non è lunica altra disposizione eccetera GRAFO = Insieme di vertici collegati da alcuni spigoli vertici spigoli

33 Quanti sono i possibili grafi con n vertici? Ogni vertice può essere collegato con altri n-1 vertici Ogni spigolo collega due vertici I possibili spigoli sono n (n-1) / 2 I possibili grafi sono 2 n (n-1) / 2 Quando n = 5, ci sono al più 10 spigoli, e i grafi sono 2 10 = 1024 Grafo completo

34 Presi un grafo e una disposizione delle lettere della parola SIENA, quante probabilità ci sono che si abbiano due consonanti vicine? SIMMETRIA Dato un grafo G, è possibile formare il suo antigrafo G prendendo per G esattamente gli spigoli mancanti in G. antigrafo

35 Presi un grafo e una disposizione delle lettere della parola SIENA, quante probabilità ci sono che si abbiano due consonanti vicine? SIMMETRIA Dato un grafo G, è possibile formare il suo antigrafo G prendendo per G esattamente gli spigoli mancanti in G. Fissata la disposizione delle lettere Le consonanti sono vicine in GLe consonanti NON sono vicine nellantigrafo G Quindi la probabilità è esattamente il 50% La Matematica serve a fare i conti NON

36 GRAFI PLANARI Grafo non planare

37 GRAFI PLANARI S E I N A E possibile, per ogni piantina geografica con 5 regioni, disporre le lettere della parola SIENA in modo che le consonanti non vadano su regioni confinanti? Colorazione delle piante geografiche

38 E possibile, per ogni piantina geografica con 5 regioni, disporre le lettere della parola SIENA in modo che le consonanti non vadano su regioni confinanti Ogni piantina geografica del piano può essere colorata con 4 colori, evitando che due regioni confinanti abbiano lo stesso colore Siccome ci sono 5 regioni, due devono avere per forza lo stesso colore: basta mettere in queste due regioni la S e la N Il Teorema dei 4 colori non vale sul TEOREMA dei QUATTRO COLORI A E N I S Pianeta Ciambella buon divertimento...

39 Se gratti S I E N A Che cosa salta fuori? Grazie per lattenzione


Scaricare ppt "Le Pierangiolate n.2 Dipartimento di Ingegneria della Informazione e Scienze Matematiche Luca Chiantini presenta Se gratti S I E N A Che cosa salta fuori?"

Presentazioni simili


Annunci Google