La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

System Biology: un nuovo paradigma per la biologia molecolare. Michele Caselle Università degli studi di Torino – INFN.

Presentazioni simili


Presentazione sul tema: "System Biology: un nuovo paradigma per la biologia molecolare. Michele Caselle Università degli studi di Torino – INFN."— Transcript della presentazione:

1 System Biology: un nuovo paradigma per la biologia molecolare. Michele Caselle Università degli studi di Torino – INFN

2 Indice Idee guida System Biology, Biologia computazionale e Bioinformatica Breve ripasso di Biologia Molecolare Le innovazioni degli ultimi anni: Genomica, Trascrittomica, Proteomica Esempi di applicazioni La regolazione genica Levoluzione

3 Le idee guida: System biology e Biologia computazionale

4 La biologia computazionale Coi termini Biologia Computazionale o Bioinformatica si intende tutto ciò che riguarda lanalisi di dati biologici con metodi provenienti dalla matematica / fisica / statistica / computer-science I dati biologici (sia sequenze che annotazioni) sono raccolti in enormi banche dati open access. Tra questi dati e nascosta molta piu informazione di quanto non sia già stato pubblicato. Esiste la possibilità di ottenere risultati anche molto importanti senza che si debba fare un singolo esperimento, semplicemente rileggendo in modo originale risultati sperimentali esistenti.

5 System Biology Tre strumenti fondamentali Teoria delle reti : E sbagliato pensare alle funzioni in termini di singolo gene o singola proteina. Le funzioni complesse coinvolgono sempre molti geni in interazione tra loro. Modelli : Queste reti possono però essere scomposte in circuiti elementari (network motifs) che possono essere descritti in modo quantitativo usando equazioni differenziali o stocastiche Ontologie : E pero indispensabile cercare di standardizzare e quantificare le informazioni di tipo medico o biologico. Le ontologie sono il tentativo di miglior successo in questa direzione

6 La genomica moderna: networks Le proteine (geni) dentro una cellula formano un network. La risposta di una cellula ad un certo stimolo è una risposta globale, non di singole unità separate. H.Jeong et al. Nature, 411 (2001) 41

7 Network motifs Esempio: SIM (Single Input Module) (a) realizzazione sperimentale: la biosintesi dellarginina b) Soluzione del circuito: al variare di X (regolatore) i geni vengono attivati in tempi diversi a seconda della loro soglia di attivazione. R.Milo et al. Science 298 (2002) 824

8 La genomica moderna: Gene Ontology Gene Ontology è un modello per lunificazione di dati biologici. Lo scopo di GO è di costruire un vocabolario controllato per la descrizione di: - Molecular function - Biological process - Cellular component di un certo gene. I vocabolari sono organizzati in un network gerarchico. The G.O. Consortium Nature Genet. 25 (2000) 25

9 La Biologia Molecolare Classica

10 La cellula Ogni organismo vivente è composto da una o più cellule. Ogni cellula può essere vista come una macchina complessa che esegue delle istruzioni scritte e memorizzate nel proprio genoma.

11 Il DNA Il genoma di un qualunque organismo è costituito da una lunghissima molecola di DNA.

12 Il DNA Una molecola di DNA è formata da quattro tipi diversi di nucleotidi (A, C, G o T), legati tra di loro con legami covalenti a formare una lunga catena orientata. In ogni molecola di DNA, sono presenti due catene appaiate, tenute assieme da legami idrogeno

13 Le proteine: le macchine del nostro organismo La maggior parte delle funzioni del nostro organismo sono eseguite da proteine. Le proteine sono macromolecole formate da catene di amminoacidi.

14 Linformazione dentro la cellula Dogma centrale della biologia molecolare

15 Sintesi delle proteine

16 Il codice genetico Il passaggio dallalfabeto con cui è scritto il DNA allalfabeto con cui sono scritte le proteine avviene tramite il codice genetico.

17 Le novita degli ultimi 10 anni Alla fine degli anni 90 nasce era genomica La biologia diventa sempre più quantitativa: sequenziamento dei genomi di interi organismi microarray dati proteomici Gene Ontology

18 Perche si parla di una nuova era ? Perchè siamo in presenza di una vera e propria rivoluzione tecnologica : - diminuzione dei costi di sequenziamento, - introduzione di tecnologie high-throughput -Aumento della scala tipica degli esperimenti (e del numero di persone coinvolte).

19 Nuove domande, nuove idee - Perché i geni sono così pochi? -A cosa serve il DNA non codificante? -Quanto siamo diversi dalle scimmie? -Il dogma centrale e falso: a un gene corrispondono molte proteine (splicing alternativo) - Linformazione genetica puo andare dal DNA allRNA (Retrotrasposoni)

20 La genomica moderna: sequenze > homo_sapiens ACTTTTTTACCCTCGTGTGTTGC AGACTTTTTGCCACTTTTAAAAC GCTGACAATTCGACCCTTTCCAA GTGCAAAAAGTGCCAAGATTTA CGATAAAATTCCCCCGAGAGAC GTGTGCA……… Automatizzazione dei processi di sequenziamento del DNA Sequenziamento sistematico di molti organismi. Nascita delle banche dati genomiche

21 Dimensioni dei genomi (Mb) Procarioti: Mycoplasma Genitalium 0,58 Escherichia Coli 4,64 Eucarioti: Saccaromices cerevisiae 12 Arabidopsis thaliana 100 Drosophila Melanogaster 140 Caenorabditis Elegans 100 Homo Sapiens 3000

22 Struttura del Genoma -La densita di sequenze codificanti proteine (o RNA) diventa sempre piu bassa man mano che aumenta la complessita dellorganismo. E molto alta nei Procarioti, media nel lievito, bassissima nelluomo. La maggior parte del genoma umano ( 99%) non e codificante ! -Questo DNA non codificante e (probabilmente) coinvolto nella regolazione dellespressione genica.

23 Struttura dei Geni Un tipico gene umano ha una struttura interna molto complessa: e composto da un set di sequenze codificanti (dette esoni) separate da sequenze non codificanti (dette introni). Gli esoni possono essere combinati in molti modi diversi a formare proteine diverse (splicing alternativo)

24 Il Genoma umano

25 Ensembl Genome Browser

26 Zoom !

27 La trascrittomica: microarray In un esperimento di microarray si misura il livello di espressione (mRNA) di migliaia di geni contemporaneamente log 2 (ratio) timepoints gene

28 La proteomica: Studio sistematico della struttura 3D delle proteine mediante X-ray spectroscopy Studio sistematico delle interazioni tra proteine g 2 (ratio) ts

29 Due esempi di ricerca Il problema della regolazione genica Verifiche dei modelli evolutivi

30 Esempio: Regolazione genica

31 Il problema della regolazione genica Sequenza del genoma umano (2001 draft, 2004 finished) –3.2 x 10 9 bp di DNA –~ 3 % codifica per proteine: i mattoni elementari –~ 97 % non codifica: – è il libretto di istruzioni Contiene le sequenze che regolano lespressione dei geni in proteine ~ geni:proteine

32 Il problema della regolazione genica La maggioranza dei geni specifica uno o più proteine:espressi. Lespressione dei geni coinvolge un intermediario detto messaggero or mRNA. Il processo di espressione inizia con una fase dettatrascrizione che è accuratamente controllata in ogni tipo cellulare. Regolazione trascrizionale

33 Il problema della regolazione genica Negli eucarioti superiori (es: uomo) levento di trascrizione è molto complesso

34 Il problema della regolazione genica Negli eucarioti superiori la risposta trascrizionale è organizzata in un network.

35 Il problema della regolazione genica Regolazione trascrizionale: fattori di trascrizione (TF) si accoppiano a particolari DNA motifs (TFBS) localizzati upstream del gene regolato. EXON 1EXON 2INTRON 5 UPSTREAM3 DOWNSTREAM TRASCRITTO PRIMARIO TSS TF RNA polymerase II TFBSs

36 Dove è nascosta linformazione? Obiettivo: identificare, a partire dalla sola sequenza genomica, dei candidati TFBS ovvero identificare il vocabolario di DNA motifs che regolano lespressione dei geni. TFBS sono di solito corti (5-20 bp di DNA). TFBS sono di solito variabili. TFBS sono di solito dispersi su lunghe distanze( bp nel caso umano ). TFBS sono di solito attivi in entrambe le orientazioni. Il rapporo segnale / rumore è molto basso !

37 Risultati Alla fine si ottiene un dizionario di putative TFBSs.

38 Il problema della verifica dei modelli evolutivi

39 La verifica di modelli evolutivi può essere eseguita con opportuni algoritmi di allineamento di sequenze.

40 Il problema della verifica dei modelli evolutivi Il 96% del genoma umano è uguale nello scimpanzè.

41 Evoluzione e regolazione Obiettivo: identificare, a partire dalla sola sequenza genomica, i segnali dellevoluzione dei geni nel tempo e tra i vari organismi e riconoscere i geni ortologhi. Usare la conservazione filogenetica per selezionare le regioni funzionalmente importanti del genoma Nel genoma umano ci sono sequenze ultraconservate che sono state protette dai cambiamenti evolutivi per milioni di anni. In alcuni casi queste sequenze NON sono codificanti. Molto probabilmente hanno un ruolo nella regolazione della espressione genica.

42 FOXP2 !! Mutazioni (SNPs) nel gene FOXP2 causano severe alterazioni nel linguaggio parlato.

43 Un esempio più sofisticato: Circuiti di regolazione misti conservati tra topo e uomo

44 Transcription Factors and miRNAs Wassermann, Nat. Rev. Genetics Transcription Factors (TFs): proteins binding to specific recognition motifs (TFBSs) usually short (5-10 bp) and located upstream of the coding region of the regulated gene. MicroRNAs (miRNAs) are a family of small RNAs (typically nucleotide long) that negatively regulate gene expression at the posttranscriptional level, (usually) thanks to the seed region in 3-UTR regions. Regulation of gene expression mainly mediated by:

45 Our Project Several methods exist to study, separately TF-related and microRNA-related regulatory networks, but comparable information is lacking to explicitly connect them. The main goal of our project was to infer and then combine the two networks looking in particular for Mixed Feed-Forward Regulatory Loops --> a network motif in which a master Transcription Factor (TF) regulates a miRNA and together with it a set of Joint Target coding genes. TF Joint Target miR Hornstein E, Shomron N, Nat Genet 38 Suppl:S20–4 (2006).

46 Results Human Transcriptional Network --> Fixing 0.1 as FDR level, we obtained a catalogue of 2031 oligos that can be associated to known TFBSs for a total of 115 different TFs. --> target a total of genes (20972 protein-coding and 187 miRNAs) Human Post-Transcriptional Network --> Fixing 0.1 as FDR level, we obtained a catalogue of 3989 oligos (7-mers). 182 of them turned out to match with at least one seed present in 140 mature miRNAs. --> target a total of genes Human mixed FFLs catalogue --> We were able to obtain a list of 5030 different single target circuits, corresponding to 638 merged circuits. --> involving a total of 2625 joint target genes (JTs), 101 TFs and 133 miRNAs. # of JTs ranged from 1 to 38. TF JT 1 miR JT 2 JT …

47 Functional role of mixed FFLs Depending on the type of transcriptional regulation (excitatory or inhibitory) exerted by the master TF on the miRNA and on the targets, FFLs may be classified as incoherent (type I FFLs), or coherent (type II FFLs).

48 Type I and II FFLs TF Joint Target miR TF Joint Target miR TF Joint Target miR TF Joint Target miR type I circuits type II circuits Possible biological role for mixed TF/miRNA network motifs:

49 Main role: noise dumping Type I (incoherent) can stabilize the steady state production of a protein by dumping translational and transcriptional fluctuations. In a simple TF-target interaction any fluctuation of master TF could induce a non-linear increase in the amount of its target products. The presence, among the targets, of a miRNA which downregulates the other targets might represent a simple and effective way to control these fluctuations.

50 Study of protein fluctuations via stochastic equations In both cases fluctuations are proportional to the mean number of proteins produced by a single mRNA. This number is a function of the miRNA-mRNA affinity. The only way to address this issue is to describe the FFLs in terms of stochastic equations and to compare the results with those obtained with that of a standard transcription +translation process

51 Stochastic equations for gene expression: two steps model. This model assumes that the promoter is always active and so has only two stochastic variables: the number of mRNAs and the number of proteins

52 The probability of having m mRNAs and n proteins at time t satisfies the master equation:

53 The corresponding mean value and fluctuations of the number of proteins are: Where b is the mean number of proteins produced by a single mRNA (burst parameter). Fluctuations only depend on the burst parameter b.

54 The noise reduction can be traced back to the different efficiency of the mRNA translation in the two cases With this choice of parameters each mRNA produces a mean of 30 proteins while in the FFL this numebr is reduced to about 20. The noise reduction is a function of the miRNA-mRNA affinity Comparison between FFL noise and plane transcription

55

56 References D. Cora, C. Herrmann, C. Dieterich, F. Di Cunto, P. Provero and M. Caselle Ab initio identification of putative human transcription factor binding sites by comparative genomics. BMC Bioinformatics 2005, 6:110. D. Cora, M. Caselle, F. Di Cunto and P. Provero Identification of candidate regulatory sequences in mammalian 3 -UTRs by statistical analysis of oligonucleotide distributions. BMC Bioinformatics May 24;8:174. D. Cora, A. Re, D. Taverna and M. Caselle Genome-Wide Survey of MicroRna-Transcription Factor Feed-Forward Regulatory Circuits in Human Molecular BioSystems Aug; 5(8):

57 Thanks to C. Bosia, D. Cora Dep. of Theoretical Physics M. El Baroudi University of Torino and M. Osella A. Re CIBIO University of Trento D. Taverna Dep. of Genetics, Biology and Biochemistry and M.B.C. University of Torino

58


Scaricare ppt "System Biology: un nuovo paradigma per la biologia molecolare. Michele Caselle Università degli studi di Torino – INFN."

Presentazioni simili


Annunci Google