La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Il concetto di razza nella storia della biologia Ippocrate (460-377 a.C.) La costituzione fisica dipende dal clima e dallo stile di vita Aristotele (384-322.

Presentazioni simili


Presentazione sul tema: "Il concetto di razza nella storia della biologia Ippocrate (460-377 a.C.) La costituzione fisica dipende dal clima e dallo stile di vita Aristotele (384-322."— Transcript della presentazione:

1 Il concetto di razza nella storia della biologia Ippocrate ( a.C.) La costituzione fisica dipende dal clima e dallo stile di vita Aristotele ( a.C.) I capelli crespi degli Etiopi sono dovuti al clima arido I capelli lisci degli Sciti sono dovuti al clima umido Leonardo da Vinci ( ) Mette in dubbio l’ipotesi degli effetti dell’ambiente e ipotizza l’esistenza di un “potere” presente nel seme materno

2

3

4

5 IL GENOMA UMANO E’ PARAGONABILE AD UN LIBRO DI ISTRUZIONI CHE CONTIENE DI CARATTERI

6

7 SNP: single nucleotide polymorphism GGACCCTGCAGCTGAACTGCAGGTCGACATTGCATGGCATGGGCACGTTGGCCCCAAA GGACCCTGCAGCTGAACTGCAGGTCGACGTTGCATGGCATGGGCACGTTGGCCCCAAA...

8 Multiregional model Population replacement model EUROPA AFRICA ASIA EUROPA AFRICA ASIA

9 oggi anni

10 AATCGATAAG TA AATCGATATG TA AATCGATGTG TA AATCAATGTG TA AATTGATATGT A AATTGATATAT A TATCGATATGT A TATCGATATGT T TATCGTTATGT T TATCGACATG TA POLIMORFISMI SUL CROMOSOMA 21

11 oggi anni Ht1 Ht7,8 Ht2 Ht5

12 Il colore delle pelle Il colore della pelle dell’uomo è un carattere genetico poligenico (3-6 geni principali) Questi geni controllano la quantità, la densità e la distribuzione della melanina Le popolazioni sviluppatesi in varie parti del mondo sono state sottoposte ad una pressione selettiva che ha inciso su alcuni caratteri come il colore della pelle

13 La selezione del colore della pelle A basse latitudini hanno avuto un vantaggio selettivo gli individui con pelle ad alto contenuto e densità di melanina (pelle scura) I raggi UV provocano: scottature -> infezioni cancro della pelle denaturazione dell’acido folico -> anemia, infertilità Ad alte latitudini hanno avuto un vantaggio selettivo gli individui con pelle a basso contenuto e densità di melanina (pelle chiara) I raggi UV sono indispensabili per la trasformazione della vitamina D nella sua forma attiva. La carenza di vitamina D provoca gravi malattie.


Scaricare ppt "Il concetto di razza nella storia della biologia Ippocrate (460-377 a.C.) La costituzione fisica dipende dal clima e dallo stile di vita Aristotele (384-322."

Presentazioni simili


Annunci Google