La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Bioinformatica Corso di Laurea specialistica in Informatica Biologia Molecolare: cellule, genomi ed evoluzione 14/03/2011.

Presentazioni simili


Presentazione sul tema: "Bioinformatica Corso di Laurea specialistica in Informatica Biologia Molecolare: cellule, genomi ed evoluzione 14/03/2011."— Transcript della presentazione:

1 Bioinformatica Corso di Laurea specialistica in Informatica Biologia Molecolare: cellule, genomi ed evoluzione 14/03/2011

2 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

3 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

4 Gli organismi viventi La Biodiversità Per Biodiversità si intende la varietà delle forme di vita sulla terra. Tale diversità è identificabile a diversi livelli: -Genetica -Specie animali, vegetali e microbiche -Ecosistemi e specializzazioni ecologiche legate allambiente in cui le specie vivono. È stimato che oggi sulla terra sono presenti specie viventi

5 Gli organismi viventi Le caratteristiche degli organismi viventi Le caratteristiche fondamentali dei viventi sono: Possesso di un programma genetico ereditabile Capacita di esprimere il proprio programma genetico Queste caratteristiche provocano la capacità dei viventi di SOPRAVVIVERE al fine di DIFFONDERSI. Poiché si considerano organismi viventi tutti i sistemi costituiti da cellule, la cellula rappresenta lunità fondamentale della vita.

6 Gli organismi viventi Le caratteristiche principali degli organismi viventi Sono formati da una o più cellule Crescono Si riproducono Muoiono Utilizzano energia Hanno una interazione con lambiente (reagiscono agli stimoli) Si evolvono

7 Gli organismi viventi Levoluzione Si pensa che tutti gli organismi e tutte le cellule che li costituiscono siano derivati da una cellula progenitrice (GENOTOPE) in seguito ad una evoluzione per selezione naturale. 2 teorie sullevoluzione Lamarck gli organismi viventi si modificano gradualmente nel tempo adattandosi all'ambiente: l'uso o il non uso di determinati organi porterebbe con il tempo ad un loro potenziamento o ad un'atrofia. EREDITARIETA dei CARATTERI ACQUISITI Darwin la lotta per la vita è il motore dell'evoluzione. Mutazioni genetiche casuali generano la diversità sulla quale agisce la selezione operata dallambiente. IL più FORTE SOPRAVVIVE e RIPRODUCENDOSI TRASMETTE I CARATTERI MIGLIORI per LAMBIENTE

8 Gli organismi viventi La sola figura nellopera di Darwin The Origin of Species (1859)

9 Gli organismi viventi La classificazione filogenetica è un sistema artificiale che stabilisce dei confini tra gruppi di organismi originatisi mediante un processo continuo: levoluzione. Questo ha posrtato negli anni a numerose controversie nella identificazione dei gruppi tassonomici degli organismi. La filogenesi Classificazione degli organismi viventi

10 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

11 Procarioti ed eucarioti Esistono due categorie di cellule che si distinguono sulla base di una caratteristica morfologica fondamentale: La presenza o lassenza del NUCLEO I Procarioti Sono il tipo di cellule meno complesso. Non possiedono il nucleo. Un un sistema esterno (parete + membrana citoplasmatica) racchiude un unico compartimento entro il quale sono contenute tutte le componenti cellulari. I procarioti tipici sono i BATTERI Gli Eucarioti Sono cellule più complesse. Hanno un nucleo che separa il materiale genetico dal resto della cellula (citoplasma). Un sistema di compartimenti interni delimitati da membrane racchiude microambienti per specifiche funzioni cellulari. Tutti gli animali e le piante SUPERIORI sono Eucarioti

12 Procarioti ed eucarioti Cellula eucariotica Dimensioni: da 5 a 100 μm (con le dovute eccezioni) Organelli: nucleo, mitocondri, cloroplasti, reticolo endoplasmatico, etc... Citoscheletro: assente Organizzazione cellulare: in genere pluricellulare Cellula procariotica Dimensioni: da 1 a 10μm Organelli: nessuno Citoscheletro: assente Organizzazione cellulare: unicellulare

13 I Procarioti I procarioti sono strutturalmente più semplici degli eucarioti ma il numero di specie, di forme e di funzionalità rappresentate da questi organismi li rende un gruppo molto eterogeneo. Sono unicellulari e TUTTE le funzioni dellorganismo (nutrizione, relazione con lambiente esterno, riproduzione, movimento) sono svolte contemporaneamente dalla stessa cellula. Possiedono un solo cromosoma circolare, ma possono avere diverse piccole molecole di DNA circolare accessorie: i plasmidi. I plasmidi giocano un ruolo importante nella trasmissione dellinformazione genetica trasversale (da batterio a batterio) Si riproducono per fissione binaria producendo, a partire da una cellula progenitrice, due cellule morfologicamente e geneticamente identiche. Il ciclo cellulare è molto rapido ed in condizioni ottimali riescono a decuplicare il numero di individui di partenza in tempi brevissimi La struttura dei geni, nei procarioti, è più semplice rispetto a quella degli eucarioti.

14 Gli Eucarioti Gli eucarioti sono strutturalmente più complessi, presentano numerosi compartimenti in cui le reazioni chimiche del metabolismo possono essere ottimizzate (in compartimenti chiusi di dimenzione inferiore è possibile esercitare maggior controllo sui processi e la diffusione chimica delle molecole è facilitata) Possono essere sia unicellulari (ad esempio il lievito) sia pluricellulari. Negli organismi pluricellulari le cellule si specializzano per funzione andando a costituire TESSUTI che a loro volta possono formare gli ORGANI. Nasce la necessità di comunicare: le funzioni dei vari tessuti ed organi deve essere sincronizzata. Hanno DNA lineare organizzato in cromosomi. Lunghezza superiore a quella degli eucarioti. Nasce la necessità di compattare il materiale genetico. La struttura dei geni, negli eucarioti, è più complessa. I geni sono interrotti da sequenze non codificanti ed esistono numerosi elementi deputati alla regolazione dellespressione dei geni. Solo negli eicarioti riproduzione e sessualità sono strettamente correlate.

15 Da Procarioti ad Eucarioti Una teoria evoluzionistica

16 Gli organelli citoplasmatici Gli eucarioti sono caratterizzati da strutture interne spesso delimitate da membrana: -Nucleo: Contiene il materiale genetico (DNA). Allinterno del nucleo avviene anche la trascrizione e la maturazione dellRNA -Mitocondri: organelli deputati alla produzione di energia (ATP) tramite respirazione cellulare -Reticolo endoplasmatico (ER): sede della sintesi dei lipidi (componendti delle membrane cellulari) -Apparato del Golgi: modificazione e trasporto di molecole destinate allesterno della cellula -Cloroplasti: organelli deputati alla fotosintesi clorofilliana (piante verdi e cianobatteri) -Lisosomi: vescicole digestive conteneti enzimi per la degradazione di molecole complesse e di vecchi apparati da eliminare.

17 I mitocondri Una teoria evolutiva I mitocondri hanno un genoma indipendente, una doppia membrana che li separa dal citoplasma, dei ribosomi, una replicazione indipendente dal resto della cellula e tutte quelle caratteristiche che lasciano sospettare si sia verificato un fenomeno di simbiosi tra un batterio ancestrale capace di effettuare la respirazione cellulare, ed una cellula eucariotica ancestrale che lo ha inglobato, senza distruggerlo, ottenedo un vantaggio reciproco. Teoria Endosimbiontica

18 I cloroplasti Una teoria evolutiva Anche i cloroplasti hanno un genoma indipendente, una doppia membrana, dei ribosomi, una replicazione indipendente dal resto della cellula e tutte quelle caratteristiche che lasciano sospettare si sia verificato un fenomeno di simbiosi tra un batterio ancestrale capace di effettuare la fotosintesi clorofilliana, ed una cellula eucariotica ancestrale che lo ha inglobato, senza distruggerlo, ottenedo un vantaggio reciproco. Teoria Endosimbiontica

19 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

20 I costituenti della materia vivente Molecole di base e macromolecole Tutte le cellule sono costituite da macromolecole. Le macromolecole sono polimeri (molecole di grandi dimensioni) costituiti da ripetizioni di singoli monomeri (elementi costitutivi di base). Esistono quattro proncipali classi di macromolecole, costituite rispettivamente da quattro classi di monomeri: -Proteine (costituite da amonoacidi) -Acidi Nucleici (costituiti da nucleotidi) -Lipidi (costituiti da acidi grassi e glicerolo) -Polisaccaridi (costituiti da zuccheri semplici o monosaccaridi)

21 I costituenti della materia vivente Molecole di base e macromolecole

22 I costituenti della materia vivente I legami chimici Le molecole sono formate da ATOMI, che interagiscono tra loro tramite LEGAMI CHIMICI. Un legame chimico è una interazione che gli atomi contraggono sulla base delle loro caratteristiche chimiche. Esistono legami chimici di diversa forza e natura: Il legame covalente è un legame forte. Sia la formazione che la rottura di un legame di questo tipo richiede una energia molto elevata. I legami covalenti sono fondamentali per la formazione dello scheletro che tiene insieme i singoli monomeri di una macromolecola. I legami non covalenti sono legami deboli. La formazione e la rottura di questi legami è dinamica a causa della bassa quantità di energia coinvolta nel legame. I legami non covalenti sono fondamentali in tutti i processi biologici dinamici come la trasmissione dellinformazione, lacquisizione di struttura tridimensionale, etc. Il legami non covalenti si dividono in: Legami ad Idrogeno Legami ionici Attrazioni di Van Der Waals

23 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

24 Le macromolecole: natura ed informazione I Lipidi I lipidi sono delle molecole idrofobiche: sono insolubili in acqua ma solubili in solventi organici. Nella cellula sono presenti diversi tipi di lipidi che possono svolgere funzioni di: Accumulo di energia (sotto forma di TRIGLICERIDI) Formazione delle membrane biologiche (che essendo idrofobiche formano degli strati impermeabili che separano fisicamente 2 compartimenti acquosi Segnalazione chimica (gli steroidi sono ormoni derivanti dal colesterolo che svolgono il compito di regolare lattività di cellule bersaglio)

25 Le macromolecole: natura ed informazione I polisaccaridi I polisaccaridi sono grandi molecole costituite da monotone ripetizioni di mono o disaccaridi. I monosaccaridi sono zuccheri semplici, le unità più semplici dei carboidrati, i disaccaridi sono costituiti da due monosaccaridi diversi. Il Glicogeno e Lamido sono polimeri costituiti da lunghissime ripetizioni del monosaccaride glucosio Il Saccarosio è un disaccaride costituito da glucosio e fruttosio. Le funzioni principali dei polisaccaridi sono: Funzione energetica Funzione di segnalazione al livello della superfice cellulare

26 Le macromolecole: natura ed informazione Gli Acidi Nucleici Gli acidi nucleici sono molecole acide, che sono state individuate inizialmente nel nucleo delle cellule eucariotiche, costituite da nucleotidi. Il DNA rappresenta il supporto molecolare di tutta linformazione genetica presente nelle cellule eucariotiche, nelle cellule procariotiche e nei virus a DNA. LRNA rappresenta il mezzo di trasmissione dellinformazione, contenuta nel DNA, in tutte le cellule eucariotiche e procariotiche. Esso rappresenta probabilmente la più antica macromolecola biologica.

27 Le macromolecole: natura ed informazione I Nucleotidi NH 2 N N N N Base P O OH HO O Phosphate DEOSSINUCLEOTIDE A; C; G; T OH O CH 2 Sugar H DNA

28 Le macromolecole: natura ed informazione I Nucleotidi RNA NH 2 N N N N Base P O OH HO O Phosphate RIBONUCLEOTIDE A; C; G; U OH O CH 2 Sugar OH

29 Le macromolecole: natura ed informazione Esistono due gruppi di nucleotidi che si distinguono sulla base della loro natura chimica (singolo anello o doppio anello)

30 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

31 IL DNA: natura ed informazione Come detto in precedenza il DNA è una sequenza di 4 diversi nucleotidi. Lo zucchero ed il fosfato di ogni nucleotide costituisco lossatura costante del filamento di DNA mentre le diverse basi azotate sporgono permettendo linterazione con altro filamento di DNA Le basi azotate, infatti, sono particolarmente predisposte ad interagire tra loro attraverso legami ad idrogeno (legami deboli) altamente specifici. Le Adenine possono interagire solo con le Timine e le Guanine possono interagire solo con le Citosine.

32 IL DNA: natura ed informazione La legge della complementarietà delle basi: Poiche i legami ad idrogeno tra basi appartenenti a nucleotidi giustapposti (appartenenti a filamenti differenti) costringono ad una specificità nellinterazione, i due filamenti di DNA sono COMPLEMENTARI C G A T G C Se in un filamento è presente una T nellaltro filamento deve essere presente una A. E possibile sempre ricostruire la sequenza di un filamento a partire dalla sequenza del suo complementare.

33 IL DNA: natura ed informazione Struttura del DNA: la doppia elica La molecola di DNA consiste di due catene polinucleotidiche unite mediante le basi azotate e avvolte luna sullaltra a formare una doppia elica destrorsa. Le due catene sono antiparallele cioe i due filamenti sono orientati in direzione opposta: uno orientato in 5-3 e laltro in 3-5. Gli scheletri di zucchero fosfato si trovano allesterno della doppia elica, mentre le basi sono orientate verso lasse centrale.

34 IL DNA: natura ed informazione Contenuto informativo del DNA La struttura del DNA è costante. Il DNA è sempre una doppia elica INDIPENDENTEMENTE dalla sequenza di nucleotidi che lo compone. Lossatura di zucchero e fosfato è costante. La parte variabile, e quindi più informativa, è rappresentata dalla sequenza di BASI AZOTATE. Per questo motivo, in bioinformatica, linformazione contenuta nel DNA è rappresentata da una stringa composta da un alternanza 4 caratteri che rappresentano le basi azotate del DNA. GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGG AGCTGAGGAGCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGG TCGCACACATCCACCGGCGCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCG CCGCTCAGGGGCGGGAAGAGGAGGCGGTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGG ATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTA CTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGCTACCAACGAGACCAATGT TAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTTGTGTTTAAG GCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAATA CACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAA

35 IL DNA: natura ed informazione Contenuto informativo del DNA LINFORMAZIONE ALLINTERNO DELLA MOLECOLA DI DNA E QUALITATIVAMENTE OMOLOGABILE AD UN DATO NUMERICO IN BASE 4 SI DISTINGUE: A) INFORMAZIONE DIRETTA (INTRINSECA) 2-3% GENOMA UMANO TRASCRITTO IN RNA (GENI) B) INFORMAZIONE INDIRETTA (ESTRINSECA) DOVUTA ALLA STRUTTURA CHE IL DNA STESSO ASSUME

36 IL DNA: natura ed informazione Termini chiave -Il genoma è linsieme completo delle sequenze che costituiscono il materiale genetico di un organismo. Negli eucarioti comprende le sequenze di DNA cromosomico più qualunque sequenza di DNA presente negli organelli -Il gene è una porzione del genoma che contiene linformazione per la produzione di una proteina, e per la sua regolazione. Esso rappresenta lunità funzionale del genoma -Il genoma è suddiviso, da un punto di vista fisico, in cromosomi. Ogni cromosoma è una unità fisica indipendente che comprende molti geni.

37 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

38 I cromosomi E stato calcolato che la lunghezza totale di tutte le molecole di DNA che costituiscono il genoma di UNA cellula è di circa 2 metri. Il problema di spazio occupato dal materiale genetico è stato superato mediante meccanismi recursivi di superavvolgimento che permettono di compattare il DNA in strutture più dense. La presenza di alcune proteine, chamate ISTONI, legate al DNA permette di raggiungere un elevato grado di compattamento. Esistono diversi gradi di compattamento del DNA che sono dipendenti da necessità funzionali: tanto più compatto è un tratto di DNA tanto meno verrà utilizzata la sua informazione. Prima di essere utilizzato un segmento genico deve essere decompresso, quando non serve più può essere compresso di nuovo. Questa situazione è estremamente dinamica. La massa totale di DNA presente nel nucleo viene chiamata CROMATINA La cromatina più compatta (e funzionalmente non attiva) viene chiamata ETEROCROMATINA La cromatina meno compatta (è più attiva) viene chiamata EUCROMATINA

39 I cromosomi Il massimo grado di compattamento del DNA si raggiunge durante i processi di divisione cellulare. Durante questo processo il DNA deve essere diviso in maniera eguale alle 2 cellule figlie che si originano dalla cellula progenitrice: è necessario che sia compatto e resistente per evitare rotture e facilitare un equa distribuzione (processo meccanico). E in questa fase che i cromosomi assumono la forma ad X che tutti conosciamo. Nelluomo esistono 23 coppie di cromosomi, 22 delle quali sono delle coppie di cromosomi identici tra loro (AUTOSOMI) mentre 1 è costituita da una coppia che può essere eterogenea e definisce il sesso dellindividuo (ETEROSOMI o CROMOSOMI SESSUALI) Nella donna gli eterosomi sono due cromosomi chiamati X Nelluomo gli eterosomi sono un cromosoma X ed un cromosoma più piccolo chiamato Y

40 I cromosomi La Diploidia La condizione per la quale i cromosomi nelluomo (ed in molti altri organismi) sono organizzati in coppie viene definita DIPLOIDIA. In ogni coppia si avrà un cromosoma di origine materna ed un cromosoma di origine paterna. Tutte le cellule dellorganismo possiedono un corredo genetico di tipo diploide ad eccezione dei gameti, che sono le cellule deputate alla riproduzione. Queste cellule hanno un corredo genetico dimezzato che si definisce aploide: i cromosomi non si presentano a coppie ma come singole entità. Il motivo di questa diversità è semplice: con la fecondazione 2 gameti si fondono mettendo in comune i propri cromosomi, se non ci fosse questo dimezzamento a livello della produzione dei gameti, il nuovo organismo avrebbe un corredo cromosomico di 92 cromosomi organizzati in quartetti.

41 Outline Organismi Cellule eucariotiche e procariotiche Molecole di base – Legami Macromolecole – Natura ed informazione DNA: la sequenza della vita – Natura ed informazione Cromosomi Duplicazione del DNA

42 La replicazione del DNA E fondamentale che ad ogni divisione cellulare il DNA venga COPIATO in modo che ogni cellula figlia abbia un corredo genetico identico a quello della cellula progenitrice. La conseguenza principale della scoperta della struttura del DNA ad opera di Watson e Crick è stata la comprensione dei maccanismi di replicazione del DNA, che può essere definita SEMICONSERVATIVA e SEMIDISCONTINUA

43 La replicazione del DNA La replicazione è conservativa o semiconservativa? Modello conservativoModello semi-conservativoModello distributivo Una delle cellule figlie eredita la doppia elica parentale, laltra quella appena sintetizzata Entrambe le le cellule figlie ereditano un filamento parentale vecchio ed uno neosintetizzato Entrambe le le cellule figlie ereditano un parti di filamento parentale vecchio e parti neosintetizzati

44 La replicazione del DNA La replicazione semiconservativa e la complementarietà delle basi Il meccanismo che permette alla duplicazione del DNA di avvenire senza errori e di conservare linformazione contenuta nelle molecole parentali è la complementarietà delle basi, ottenuta attraverso la specificità dei legami ad idrogeno. I legami ad idrogeno che tengono insieme i due filamenti della doppia elica di DNA sono legami deboli. Possono essere rotti in maniera controllata senza grosse difficoltà. Questo propcesso prende il nome di DENATURAZIONE. Ognuna delle eliche separate può servire da stampo per la sintesi del filamento complementare. Lapertura dei due filamenti della doppia elica (duplex) parentale è soltanto transitoria e la struttura si ripristina nel momento in cui si formano i duplex figli. In ogni particolare istante, la separazione in filamenti singoli riguarda solo un piccolo tratto del DNA duplex. La forca di replicazione si sposta man mano che la replicazione procede.

45 La replicazione del DNA La replicazione inizia in corrispondenza di una specifica sequenza chiamata origine di replicazione. Alcune proteine si legano al DNA in corrispondenza dellorigine e cominciano a svolgerlo. A questo punto delle proteine iniziatrici possono accedere ad ognuno dei filamenti per iniziare la sintesi del nuovo DNA. La proteina deputata alla sintesi del DNA complementare ad uno stampo è la DNA POLIMERASI. Questo enzima catalizza laggiunta di nuovi nucleotidi ad una molecola di DNA quindi NON è in grado di iniziare dal nulla la sintesi di una nuova molecola. Prima che la DNA polimerasi possa iniziare la sintesi di un nuovo filamento, deve intervenire lenzima PRIMASI, un enzima che sintetizza un breve segmento di RNA sullo stampo del DNA. Su questo innesco (in inglese primer) la DNA polimerasi può aggiungere nuovi nucleotidi e continuare la sintesi. Poiche i primi nucleotidi, sintetizzati dalla primasi, sono ribonucleotidi (RNA) vengono successivamente rimossi e sostituiti con desossiribonucleotidi (DNA).

46 La replicazione del DNA Tutte le DNA polimerasi conosciute sintetizzano il nuovo filamento in direzione 5'- 3'aggiungendo deossiribonucleotidi (dNTP) al gruppo 3'-OH del [deossiribosio] del nucleotide precedente. Su un filamento la replicazione può procedere nello stesso verso in cui si sposta la DNA polimerasi, ed il processo è continuo. Nellaltro filamento questo non è possibile e deve avvenire in modo discontinuo. La sintesi del DNA ha una direzione Nel filamento LAGGING si generano dei frammenti di DNA (frammenti di Okazaki) che vengono succesivamente incollati tra loro per ricostruire un filamento continuo.

47 Le mutazioni e levoluzione La DNA polimerasi sintetizza un nuovo filamento di DNA sulla base di un filamento STAMPO. Ma la riproduzione della informazione è sempre affidabile al 100% ? In realtà la polimerasi genera un errore con una frequenza di Ogni tanto inserisce un nucleotide sbagliato (non complementare allo stampo) generando una MUTAZIONE. La impossibilità di generare un corretto appaiamento tra nucleotidi non complemantari genera nellelica nascente una deformazione spaziale. Questa deformazione può essere riconosciuta della polimerasi che può tornare indietro e correggere lerrore. Grazie a questa attivita di correzione di bozze (proof reading) la frequenza di errore scende a Le mutazioni che sfuggono alla correzione si stabiliscono nel DNA e diventano ereditabili. Le mutazioni non sono sempre brutte e cattive: sono alla base delle VARIABILITA GENETICA e quindi della EVOLUZIONE PER SELEZIONE NATURALE. La DNA polimerasi commettono degli errori

48 Le mutazioni e levoluzione Le mutazioni sono variazioni della sequenza nucleotidica del DNA. Possono essere causate da: errori durante la duplicazione del DNA esposizione delle cellule ad agenti fisici o chimici (agenti mutageni) Se la mutazione avviene allinterno di una regione di DNA implicata nella produzione di una proteina, possiamo avere una alterazione nella proteina corrispondente e di conseguenza nella funzione svolta dalla proteina in questione La DNA polimerasi commettono degli errori

49 Le mutazioni e levoluzione Effetti delle mutazioni Alterazione della funzione di una proteina Nessun effetto sulla proteina Un miglioramento della funzione


Scaricare ppt "Bioinformatica Corso di Laurea specialistica in Informatica Biologia Molecolare: cellule, genomi ed evoluzione 14/03/2011."

Presentazioni simili


Annunci Google