La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

LA TECNOLOGIA del DNA RICOMBINANTE o CLONAZIONE MOLECOLARE Corso di Biotecnologie 12 Maggio 2008.

Presentazioni simili


Presentazione sul tema: "LA TECNOLOGIA del DNA RICOMBINANTE o CLONAZIONE MOLECOLARE Corso di Biotecnologie 12 Maggio 2008."— Transcript della presentazione:

1 LA TECNOLOGIA del DNA RICOMBINANTE o CLONAZIONE MOLECOLARE Corso di Biotecnologie 12 Maggio 2008

2 DNA SORGENTE DNA BERSAGLIO VETTORE DI CLONAZIONE 1 frammentazione enzimaticalinearizzazione enzimatica 2 3 congiungimento DNA bersaglio- vettore di clonazione Rappresentazione schematica del clonaggio (I)

3 introduzione del DNA nella cellula ospite (trasformazione) e isolamento delle cellule con il gene clonato cellula ospite proteina codificata dal gene clonato Produzione della proteina dal gene clonato tutto ciò è possibile… grazie alla scoperta delle endonucleasi di restrizione

4 5- GAATTC CTTAAG – 5 SITO DI RICONOSCIMENTO EcoRI Le Endonucleasi di Restrizione (I) Enzimi batterici: endonucleasi di TIPO II: - Riconoscono e tagliano corte sequenze di DNA (4-8bp); - le sequenze riconosciute sono palindromiche, cioè risultano ugluali se lette su ogni filamento nella stessa direzione - il taglio produce estremità piatte o coesive Esempio di una delle prime endonucleasi di tipo II meglio caratterizzate: EcoRI genere: Escherichia specie: Coli ceppo: R Ordine di caratterizzazione di diverse endonucleasi appartenente allo stesso organismo ( I ) PRODOTTI FORMAZIONE DI ESTREMITÀ COESIVE 5- G AATTC CTTAA G – 5 OH P P

5 Le Endonucleasi di Restrizione (II) EnzimaSito di riconoscimento EcoR IG A A T T C C T T A A G BamH IG G A T C C C C T A G G Hind IIIA A G C T T T T C G A A KPN IG G T A C C C C A T G G NOT IG C G G C C G C C G C C G G C G EcoR VG A T A T C C T A T A G Xho IC T C G A G G A G C T C Isoschizomeri Sebbene gli enzimi di restrizione isolati siano oltre 3500, le sequenze bersaglio che possono essere tagliate sono molte di meno (appena più di duecento). E evidente che molti enzimi isolati da batteri diversi hanno la stessa specificità di sequenza,sono cioè isoschizomeri.

6 …grazie alla scoperta delle endonucleasi di restrizione… Le librerie geniche: collezione di cloni derivante dalla totalità di DNA estratto da un organismo e digerito con un enzima di restrizione: Le librerie genomiche: composta dalla totalità del DNA cromosomico di un organismo (es: se si vuole studiare lorganizzazione genica); Le librerie di cDNA: composta dallmRNA di una cellula o di un tessuto in un particolare momento (es: studiare il profilo di espressione di una particolare proteina in u particolare momento o tessuto) Estrazione del DNA cromosomico 2 Taglio del DNA con endonucleasi di restrizione (digestione parziale o totale) 3 Inserimento di ogni frammento di DNA in un vettore 4 5 Trasformazione batterica Confronto tra I principali passaggi richiesti per la costruzione di librerie genomiche e di cDNA Libreria genomica 1 Libreria di cDNA 1 Estrazione dellmRNA 2 Produzione di cDNA (trascrittasi inversa) 3 Inserimento di ogni cDNA in un vettore 4

7 Screening di librerie geniche 1. Ibridazione su colonia del DNA o si piastrano cellule provenienti dalla reazione di trasformazione su terreno con antibiotico Piastra madre Trasferimento cellule o ciascuna colonia formatasi sulla piastra madre, si trasferisce un campione su una matrice solida (membrana di nylon o nitrocellulosa) matrice o si lisano le cellule della matrice e si denatura il DNA liberato, deproteinizzandolo e legandolo irreversibilmente alla matrice Incubazione con la sonda di DNA complementare al DNA di interesse. Lavaggi che eliminano la sonda non legata. Autoradiografia che rivela i cloni identificati con la sonda Subcultura della cellule dalle colonie positive provenienti dalla piastra madre

8 Screening di librerie geniche 2. Immunodosaggio di colonie Piastra madre 2. ciascuna colonia formatasi sulla piastra madre, si trasferisce un campione su una matrice solida (membrana di nylon o nitrocellulosa) 1. Trasferimento cellule matrice 3. si lisano le cellule della matrice e si ancorano le proteine alla matrice 4. Anticorpo primario ( 5. Eliminazione per lavaggio del primario e incubazione con anticorpo secondario ( 6. Eliminazione per lavaggio del secondario non legato e si effettua una reazione cromatica che funziona solo in presenza del secondario. Subcultura della cellule dalla colonia positiva proveniente dalla piastra madre

9 Estremità piatte Esempio: HaeIII (da Haemophilus parainfluenzae) La sequenza di DNA in doppia elica: 5-NNNNGGCCNNNN-3 3-NNNNCCGGNNNN-5 viene tagliata nel seguente modo: 5-NNNNGG pCCNNNN-3 3-NNNNCCp GGNNNN-5 La sequenza di DNA in doppia elica: 5-NNNNGAATTCNNNN-3 3-NNNNCTTAAGNNNN-5 viene tagliata nel seguente modo: 5-NNNNG pAATTCNNNN-3 3-NNNNCTTAAp GNNNN-5 Estremità coesive Esempio: EcoRI Tutte le estremità generate dagli enzimi che operano un taglio sfalsato, siano esse sporgenti in 5 o in 3, sono appiccicose, cioè possono formare ponti idrogeno tra le due code a filamento singolo complementari. In questo caso il taglio è perfettamente simmetrico. Le estremità piatte sono saldate in modo inefficiente dalla DNA ligasi, perché non restano associate a lungo.

10 annealing reannealing Tutti questi appaiamenti (annealing-reannealing) sono transitori a causa della debolezza dei legami a idrogeno tra il numero ridotto di basi a livello delle estremità coesive. Questi legami vengono stabilizzati grazie alluso dellenzima DNA LIGASI in un processo noto con il nome di ligazione. Enzima T4 DNA ligasi (isolato dal batteriofago T4) forma legami covalenti tra il gruppo fosfato 5 di una estremità e il gruppo 3 OH della catena adiacente. Lenzima lavora a 10°C e richiede ATP. Rappresentazione schematica del clonaggio (II) - estremità coesive

11 Rappresentazione schematica del clonaggio (III) - estremità coesive

12 Trattamento del DNA con estremità piatte La ligazione di frammenti con estremità piatte non è efficiente quanto quella di frammenti con estremità coesive, perciò prima di unire il DNA con il vettore di clonaggio è necessario eseguire alcune procedure aggiuntive: 1.AGGIUNTA DEL LINKER DNA a estremità piatte 5 pGGGATCCC 3 CCCTAGGG linker Unione del linker al DNA con estramità piatte mediante DNA ligasi 5 pGGGATCCC 3 CCCTAGGG GGGATCCC CCCTAGGG plasmide 5 pGATCCC 3 GG GG CCCTAGp Taglio con BamHI CTAGp 5pGATC 3 C T A G G G G G G A T C G A T C C C C C C T A G Unione delle estremità coesive mediante DNA ligasi

13 Vettori per il clonaggio (I) Per clonare una qualsiasi molecola di DNA è necessario inserirla in un vettore per il clonaggio. Questi elementi di DNA possono essere mantenuti e propagati in un organismo ospite in cui il vettore possa replicarsi. Un tipico ospite è Escherichia Coli che cresce e si divide rapidamente. Qualsiasi vettore con un origine di replicazione adatta si replica con successo in E.Coli (assieme al DNA inserito). Quindi, qualsiasi DNA inserito in un vettore può essere amplificato (se ne possono produrre quantità illimitate) e usato per successive analisi Libreria genica: ogni vettore contiene un frammento diverso di DNA estraneo Isolamento di un clone mediante screening della libreria Amplificazione del singolo clone

14 Vettori per il clonaggio (II) - SONO STATI SVILUPPATI DA MOLECOLE PRESENTI IN NATURA (PLASMIDI BATTERICI, BATTERIOFAGI) O COMBINAZIONE DEGLI ELEMENTI CHE LI COMPONGONO (COSMIDI). Plasmidi (i) DNA extracromosomico circolare di piccole dimensioni presente in molti batteri che conferisce resistenza a antibiotici, capacità di metabolizzare substrati e capacità di coniugazione. anni 70: alcuni di questi vettori sono stati modificati in laboratorio (digestioni e successive ligazioni) pr costruire vettori di clonaggio (es: pBR322 da Bolivar e Rodriguez); un plasmide artificiale è molto più piccolo di quello naturale e viene più facilmente inserito nei batteri nel processo noto come trasformazione; un origine di replicazione del DNA di tipo batterico cosicchè il DNA può essere replicato dalla cellula ospite plasmidi come pBR322 hanno un origine di replicazione rilassata, che non segue cioè la divisione cellulare, in modo che la replicazione del plasmide è molto più frequente di quella cromosomica. In questo modo ogni cellula produce molte molecole di plasmide. Sono stati introdotti due geni che codificano per la rsistenza agli antibiotici in vari punti del palsmide ci sono siti singoli di riconoscimento per una serie di enzimi di restrizione. Alcuni di questi siti possono essere inseriti in un gene che codifica per la resistenza ad un antibiotico, cosicchè la presenza di un particolare inserto può essere rivelata dalla perdita di resistenza a quello stesso antibiotico (inattivazione inserzionale).

15 Vettori per il clonaggio (III) pBR322 Esempio di mutagenesi inserzionale (singolo taglio con BamHI)

16 Inattivazione Inserzionale pBR322 dig BamHI singolo sito di restrizione Frammento di DNA cromosomico dig BamHI + Plasmide contenente linserto Plasmide ricircolarizzato Plasmide che contiene più copie del frammento T4 DNA LIGASI TRASFORMAZIONE: incorporazione di piccole molecole circolari in E.Coli colonie cresciute su piastra contenente Ampicillina, crescono solo le cellule che contengono il plasmide Piastramento in replica utilizzando un tampone di velluto sterile Piastra contenente Tetraciclina crescono solo le cellule con plasmide senza insertto: incubazione Recupero delle colonie contenenti plasmide+inserto presenti sulla piastra AmpR

17 Plasmidi (ii) : pUC gene per la resistenza alla tetraciclina; origine di replicazione per E.Coli; Multiple Cloning Site (MCS) o polylinker: siti di restrizione unici più comuni; MCS è parte del gene lacZ che codifica per la -galattosidasi;

18 Plasmidi (iii) : pUC Quando si trasformano cellule di E.Coli con il plasmide pUC, il gene può essere attivato aggiungnedo nel terreno linduttore isopropil- -D-tiogalattopiranoside (IPTG), la cui presenza induce lespressione della -galattosidasi. Lezima funzionale idrolizza una sostanza incolore detta 5-bromo-4-cloro-3- indolil- -galattopiranoside (X-Gal) producendo un composto blu insolubile. 1.Vettori non ricombinanti (senza inserto) MCS GENE PER LA -GALATTOSIDASI X-Gal idrolizzato: placca blu INDUZIONE CON IPTG 2.Vettori ricombinanti (senza inserto) INSERIMENTO DEL DNA NEL MCS CON INTERRUZIONE DEL GENE -GAL INDUZIONE CON IPTG GENE INSERITO X-Gal NON idrolizzato: placca bianca

19 Vettori derivati da virus (I) -Per inserti lunghi (più di 5kb) si usano vettori derivanti dal batteriofago in quanto offrono una efficienza di clonaggio superiore di circa 16 volte rispetto ai vettori plasmidici; - il batteriofago è un fago con DNA lieare a doppia elica, lungo circa 49 kb in grado di infettare E.Coli, inserendogli il proprio DNA attraverso la membrana cellulare - il DNA del fago può replicarsi secondo due modalità: 1.si integra nel cromosoma di E. Coli dove resta quiesciente fino a quando un segnale ne promuove lescissione (ciclo lisogenico) 2.si replica aapena infetta la cellula, sintetizza le proteine della testa e della coda, si formano nuove particelle fagiche (ciclo litico)

20 Vettori derivati da virus (II) coda DNA testa I fagi sono stati utilizzati per la costruzione di librerie geniche perchè hanno permesso di introdurre frammenti più grandi di DNA rispetto ai plasmidi. Il DNA del batteriofago l è lungo circa 50 kb, approssimativamente 20 dei quali risultano indispensabili agli eventi di integrazione-escissione (I/E). Per formare le genoteche si è ragionato sulla possibilità di sostituire queste 20 kb con altrettante kb di DNA clonato. Una simile molecola di DNA si potrebbe perpetuare sotto forma di batteriofago l ricombinante tramite cicli litici forzosi.

21 Cosmidi Vector systemHost cellInsert capacity (kb) PlasmidE. coli Bacteriophage lE. coli10-20 CosmidE. coli35-45 Bacteriophage P1E. coli BAC (bacterial artificial chromosome) E. coli P1 bacteriophage-derived AC E. coli YACYeast100-2,000 Vettori di clonaggio Possono trasportare 40 kb di DNA clonato e possono essere mantenuti come plasmidi in E. Coli.

22 introduzione del DNA nella cellula ospite (trasformazione) e isolamento delle cellule con il gene clonato proteina codificata dal gene clonato Produzione della proteina dal gene clonato La trasformazione (I)

23 TRASFORMAZIONE: assunzione di DNA da parte di un organismo COMPETENZA: capacità di assumere DNA = numero di colonie positive/microgrammo di DNA trasformato 1970: Mandel and Higa osservarono che batteri, trattati con soluzioni di CaCl 2 e riscaldati velocemente, potevano essere trasformati con DNA del batteriofago λ quindi questo trattamento conferiva ai batteri un transiente stato di competenza Nel corso degli anni sono stati fatti diversi tentativi per migliorare lefficienza di trasformazione. Le due tecniche maggiormente utilizzate oggi sono: Trasformazione per CaCl 2 Elettroporazione La trasformazione (II)

24 Trasformazione Per Elettroporazione Le cellule batteriche unite al DNA vengono sottoposte ad una veloce scarica elettrica che permette la formazione di elettropori che favoriscono lentrata di DNA. Competenza: cellule trasformate /μg di DNA

25 Trasformazione in CaCl 2 Crescita di un ceppo E.Coli in terreno ricco di nutrienti. Le cellule si raccolgono quando sono in fase logaritmica

26 I cationi divalenti schermano le cariche negative sul DNA (dei gruppi fosfato) La combinazione di bassa temperatura e di cationi divalenti può aiutare a cristallizzare regioni della membrana rendendo più accessibili i canali di assunzione del DNA

27 Sommario delle fasi importanti nella clonazione del DNA 1.Vettore plasmidico e DNA esogeno da inserire devono avere estremità compatibili. I due pezzi di DNA sono fusi creando molecole di DNA ricombinante; 2.Introduzione del DNA in cellule batteriche ospiti idonee (trasformazione) 3.Selezione delle cellule resistenti allantibiotico e selezione dei cloni che hanno assunto il DNA ricombinante

28 Primo esempio di clonaggio gene di interesse BamHI EcoRI VETTORE I

29 Secondo esempio di clonaggio gene di interesse Not1 BglII VETTORE I …Come si procede ???... 1.se decido di clonare il gene di interesse BamHI-EcoRI devo essere sicura che gli stessi enzimi non tagliano allinterno della mia sequenza genica; 2.Devo disegnare due oligo, uno frw con la sequenza che possiede il sito di riconoscimento per lenzima BamHI e uno reverse che contiene il sito di riconoscimento per lenzima EcoRI 3.Amplificazione per PCR della sequenza genica di interesse con gli oligo disegnati; 4.Purificazione della PCR preparativa 5.Digestione con gli enzimi BamHI e EcoRI per la formazione delle estremità coesive 6.Digestione del vettore pOTB7 con BamH1 e EcoRI 7.Ligazione con lezima T4 DNA ligasi

30 1.se decido di clonare il gene di interesse BamHI-EcoRI devo essere sicura che gli stessi enzimi non tagliano allinterno della mia sequenza genica; 1 atggagatgg aaaaggagtt cgagcagatc gacaagtccg ggagctgggc ggccatttac 61 caggatatcc gacatgaagc cagtgacttc ccatgtagag tggccaagct tcctaagaac 121 aaaaaccgaa ataggtacag agacgtcagt ccctttgacc atagtcggat taaactacat 181 caagaagata atgactatat caacgctagt ttgataaaaa tggaagaagc ccaaaggagt 241 tacattctta cccagggccc tttgcctaac acatgcggtc acttttggga gatggtgtgg 301 gagcagaaaa gcaggggtgt cgtcatgctc aacagagtga tggagaaagg ttcgttaaaa 361 tgcgcacaat actggccaca aaaagaagaa aaagagatga tctttgaaga cacaaatttg 421 aaattaacat tgatctctga agatatcaag tcatattata cagtgcgaca gctagaattg 481 gaaaacctta caacccaaga aactcgagag atcttacatt tccactatac cacatggcct 541 gactttggag tccctgaatc accagcctca ttcttgaact ttcttttcaa agtccgagag 601 tcagggtcac tcagcccgga gcacgggccc gttgtggtgc actgcagtgc aggcatcggc 661 aggtctggaa ccttctgtct ggctgatacc tgcctcttgc tgatggacaa gaggaaagac 721 ccttcttccg ttgatatcaa gaaagtgctg ttagaaatga ggaagtttcg gatggggctg 781 atccagacag ccgaccagct gcgcttctcc tacctggctg tgatcgaagg tgccaaattc 841 atcatggggg actcttccgt gcaggatcag tggaaggagc tttcccacga ggacctggag 901 cccccacccg agcatatccc cccacctccc cggccaccca aacgaatcct ggagccacac 961 aatgggaaat gcagggagtt cttcccaaat caccagtggg tgaaggaaga gacccaggag 1021 gataaagact gccccatcaa ggaagaaaaa ggaagcccct taaatgccgc accctacggc 1081 atcgaaagca tgagtcaaga cactgaagtt agaagtcggg tcgtgggggg aagtcttcga 1141 ggtgcccagg ctgcctcccc agccaaaggg gagccgtcac tgcccgagaa ggacgaggac 1201 catgcactga gttactggaa gcccttcctg gtcaacatgt gcgtggctac ggtcctcacg 1261 gccggcgctt acctctgcta caggttcctg ttcaacagca acacatag Programma che permette di fare unanalisi di restrizione della sequenza

31

32 ggcccgtc atggagatggaaaaggagttcgagcagatcgacaagtccgggagctgggcggccatttac gccggcgcttacctctgctacaggttcctgttcaacagcaacacatag 2.Devo disegnare due oligo, uno frw con la sequenza che possiede il sito di riconoscimento per lenzima BamHI e uno reverse che contiene il sito di riconoscimento per lenzima EcoRI Costruzione delloligo frw Codina di 5-6 nt - sequenza riconosciuta dallenzima di restrizione (BamHI) – sequenza compresa di atg (codone di inizio). Loligo deve essere lungo circa nt CTAGCGGATCCGGCCCGTCATGGAGATGGAA Costruzione delloligo reverse Sequenza fino al codone di stop (stop incluso)- sequenza riconosciuta dallenzima di restrizione- e codina di 5-6 nt. Fare il reverse complement TTCCTGTTCAACAGCAACACATAGGAATTCCTAGC GCTAGGAATTCCTATGTGTTGCTGTTGAACAGGAA

33 Amplificazione per PCR della sequenza genica di interesse con gli oligo disegnati; Purificazione della PCR preparativa Digestione con gli enzimi BamHI e EcoRI per la formazione delle estremità coesive Digestione del vettore pOTB7 con BamH1 e EcoRI Ligazione con lezima T4 DNA ligasi CCGGGCAG TAC CTCTACCTTTTCCTC GGCCCGTC ATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAGTCCGGGAGCTGGGCGGCCATTTAC CGGCCGCGAATGGAGACGATGTCCAAGGACAAGTTGTCGTTGTGTATC GCCGGCGCTTACCTCTGCTACAGGTTCCTGTTCAACAGCAACACATAG CTAGCGGATCCGGCCCGTCATGGAGATGGAA AAGGACAAGTTTGTCGTTGTGT ATC CTTAAGGATCG


Scaricare ppt "LA TECNOLOGIA del DNA RICOMBINANTE o CLONAZIONE MOLECOLARE Corso di Biotecnologie 12 Maggio 2008."

Presentazioni simili


Annunci Google