La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Università Politecnica delle Marche Istituto di Biologia e Genetica Lo splicing dellRNA definizione importanza predizione Francesco Piva.

Presentazioni simili


Presentazione sul tema: "Università Politecnica delle Marche Istituto di Biologia e Genetica Lo splicing dellRNA definizione importanza predizione Francesco Piva."— Transcript della presentazione:

1 Università Politecnica delle Marche Istituto di Biologia e Genetica Lo splicing dellRNA definizione importanza predizione Francesco Piva

2 Struttura tipica dei geni umani esoniintroni

3 esone1introne1esone2introne2esone3 esone1 introne1 esone2 introne2 esone3 SPLICINGSPLICING eliminazione introni unione esoni GT AG

4 Lo splicing avviene in tutto il trascritto, anche nelle zone non codificanti

5

6

7 Segnali per il riconoscimento degli introni Motivi conservati

8 I segnali dei siti di splicing sono ben conservati tra le specie probabilmente la comparsa del meccanismo di splicing è molto antica

9

10

11

12

13

14 Meccanismo dello splicing

15 U2AF arly U2AF si lega al tratto pirimidinico a valle del sito di ramificazione snRNP U2 si lega al sito di ramificazione (richiesta idrolisi ATP) Arg-Ser le prot SR connettono U2Af con snRNP U1 si legano insieme snRNP U5 si lega al 5ss, snRNP U6 si lega a snRNP U2 snRNP U1 è rilasciato, snRNP U5 si sposta dallesone allintrone, snRNP U6 si lega al 5ss snRNP U4 è rilasciato (richiesta idrolisi ATP), snRNP U6 e U2 catalizzano la transesterificazione, snRNP U5 si lega al 3ss, il 5 ss è tagliato e si forma il cappio il 3ss è tagliato e gli esoni vengono saldati insieme, il cappio verrà deramificato

16 introne (5ss)

17 Sm protein snRNP U1

18 C5 G16 RBD: RNA binding domain

19

20 si appaia al sito di ramificazione Sm protein snRNP U2 si appaiano con snRNA U6

21 U5 U17

22 Muscolo cardiaco 1435 Muscolo uterino Lo splicing è tessuto specifico

23 Esempio di alternative splicing di un gene umano

24 Alternative splicing tessuto specifico

25 Alcuni modi di fare splicing alternativo

26 Alcuni genomi virali subiscono splicing allinterno della cellula ospite

27 equine infectious anemia virus (EIAV)

28 WT 5 -ACAGTTGTTGGCGGTTG-3 TACCACCC TTATT GGTTC AA CCGC G G T point mutations GTGAGTCTCGCACACACCTTCAGTTCT WT 144A 145C146A147G148T149T150G151T153G154G155C156G157G ex9+ ex9- % exon 9 inclusion A455E V456EF Q452P Effect of synonymous variations at CERES in CFTR exon 9 Pagani, F., Buratti, E., Stuani, C., and Baralle, F. E. (2003) J Biol Chem Pagani, F., Stuani, C., Zuccato, E., Kornblihtt, A. R., and Baralle, F. E. (2003) J Biol Chem 278, 1511 A

29 A1->12 A13->17A18->20 A21 WT The majority of random substitutions at the synonymous codons in CFTR exon 12 induce exon inclusion/1 WT AAA GAT GCT GAT TTG TAT TTA TTA GAC TCT CCT TTT GGA A1 AAG GAC GCA GAT TTG TAC TTA TTA GAT TCA CCC TTC GGA A2 AAG GAC GCG GAC TTG TAT TTA TTA GAT TCG CCG TTC GGC A3 AAA GAC GCT GAT TTG TAC TTA TTG GAT TCA CCG TTC GGA A4 AAG GAC GCG GAC TTG TAC TTA TTG GAC TCC CCC TTC GGT A5 AAG GAC GCC GAC TTG TAT TTG TTG GAC TCT CCG TTC GGT A6 AAG GAC GCC GAC TTA TAC TTG TTG GAC TCG CCT TTT GGC A7 AAA GAC GCG GAT TTG TAT TTA TTG GAT TCA CCT TTC GGC A8 AAA GAC GCA GAT TTA TAT TTG TTG GAC TCC CCG TTT GGA A9 AAA GAT GCC GAC TTA TAT TTG TTG GAT TCA CCC TTC GGC A10 AAG GAC GCT GAC TTG TAT TTA TTG GAC TCC CCA TTT GGG A11 AAA GAC GCA GAC TTG TAT TTG TTG GAC TCA CCG TTC GGT A12 AAA GAC GCA GAC TTA TAC TTA TTG GAC TCA CCG TTT GGT A13 AAA GAC GCA GAT TTG TAT TTA TTG GAT TCT CCG TTT GGG A14 AAA GAT GCG GAC TTG TAT TTA TTG GAT TCG CCA TTT GGT A15 AAG GAT GCT GAT TTA TAT TTA TTA GAC TCT CCG TTC GGT A16 AAA GAT GCG GAT TTG TAT TTG TTA GAC TCA CCG TTT GGC A17 AAA GAC GCA GAT TTA TAC TTG TTG GAT TCC CCC TTC GGC A18 AAA GAT GCA GAT TTG TAC TTG TTA GAC TCG CCC TTT GGC A19 AAG GAC GCA GAT TTG TAT TTG TTA GAC TCC CCA TTC GGG A20 AAG GAC GCT GAC TTA TAC TTG TTA GAT TCC CCT TTC GGT A21 AAG GAT GCA GAT TTA TAT TTA TTA GAC TCC CCT TTT GGT Changes in splicing efficiency are not related to the use of unpreferred synonymous codons (underlined) Nucleotide changes have different effect according to the context in which they occur

30 Intron definition / exon definition

31 Modello di exonic splicing enhancer mediato da proteine SR

32 Modello di exonic splicing silencer

33 Ricombinazione e splicing alternativo In presenza di una struttura interrotta, mutazioni neutre possono originare nuove forme di alternative splicing senza distruggere le forme funzionali già esistenti. Questa rappresenta unopportunità per levoluzione di esplorare nuovi schemi aggiungendoli eventualmente a quelli precedenti. (Pagani F, Raponi M, Baralle FE. Synonymous mutations in CFTR exon 12 affect splicing and are not neutral in evolution Proc Natl Acad Sci U S A May 3;102(18): )

34 9G8, CUG-BP1, DAZAP1, ETR-3, Fox-1, Fox-2, hnRNP-A0, hnRNP-A1, hnRNP-A2/B1, hnRNP- C, hnRNP-D, hnRNP-D0, hnRNP DL, hnRNP E1, hnRNP E2, hnRNP-F, hnRNP G, hnRNP-H1, hnRNP-H2, hnRNP-I, hnRNP J, hnRNP K, hnRNP-L, hnRNP M, hnRNP P (TLS), hnRNP Q, hnRNP U, HTra2beta1, HuB, HuD, HuR, KSRP, Nova-1, Nova-2, nPTB, PSF, Sam68, SC35, SF1, SF2/ASF, SLM-1, SLM-2, SRp20, SRp30c, SRp38, SRp40, SRp54, SRp55, SRp75, TDP43, TIA-1, TIAL1, YB-1 … Molte altre proteine partecipano allo splicing

35

36 ESE, ISS: esone ESS, ISE: introne

37 Pan troglodytes average nucleotide divergence of just 1.2%

38 Letture consigliate Nature reviews. Genetics. 2002; 3(4): Listening to silence and understanding nonsense: exonic mutations that affect splicing. Cartegni L, Chew SL, Krainer AR. PMID: Nature reviews. Genetics. 2007; 8(10): Splicing in disease: disruption of the splicing code and the decoding machinery. Wang GS, Cooper TA. PMID:


Scaricare ppt "Università Politecnica delle Marche Istituto di Biologia e Genetica Lo splicing dellRNA definizione importanza predizione Francesco Piva."

Presentazioni simili


Annunci Google