La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Il polimorfismo VNTR MNS16A del gene TERT della telomerasi umana nella popolazione italiana ELABORATO FINALE Facoltà di Scienze Matematiche, Fisiche e.

Presentazioni simili


Presentazione sul tema: "Il polimorfismo VNTR MNS16A del gene TERT della telomerasi umana nella popolazione italiana ELABORATO FINALE Facoltà di Scienze Matematiche, Fisiche e."— Transcript della presentazione:

1 Il polimorfismo VNTR MNS16A del gene TERT della telomerasi umana nella popolazione italiana ELABORATO FINALE Facoltà di Scienze Matematiche, Fisiche e Naturali Dipartimento di Biologia e Biotecnologie “C. Darwin” Relatore interno: Prof. R.M. Corbo Candidato: Maria Lacanna Relatore esterno: Dott. D. Scarabino Matricola : A.A

2 I Telomeri sequenze nucleotidiche non codificanti, ripetute in tandem alle estremità dei cromosomi sequenza TTAGGG ripetuta circa volte (5-12Kb) associati al complesso Shelterin necessari per stabiltà e completa replicazione del cromosoma

3 L’unione dei frammenti di Okazaki e la rimozione dell’ultimo primer genera nel filamento ritardato una lacuna di DNA, che rende indispensabile la presenza della telomerasi per replicare completamente le estremità. E’ una trascrittasi inversa composta dalle subunità: TERT (telomerase reverse transcripase) TERC (telomerase RNA component) Si associa alla discherina e altre proteine La Telomerasi

4 1) ESTENSIONE: la telomerasi polimerizza un primo modulo di DNA complementare all’RNA stampo 2) TRASLOCAZIONE: l’ibrido RNA-DNA si denatura e il DNA retrocede all’estremità 3’ del telomero Le due fasi si ripetono fino alla formazione di un filamento abbastanza lungo. La telomerasi si stacca e l’estremità formata si ripiega in una struttura a forcina stabilizzata da appaiamenti tra guanosine. Estensione del DNA telomerico

5 Lunghezza dei telomeri e invecchiamento I telomeri si accorciano fisiologicamente ad ogni ciclo di divisione La lunghezza dei telomeri di una cellula riflette la sua storia replicativa Al di sotto di una certa soglia si attivano specifici pathway che portano all’arresto della proliferazione cellulare e alla senescenza cellulare

6 In condizioni fisiologiche: Cellule somatiche umane bassa attività telomerasica Cellule delle gonadi maschili Cellule embrionali elevata attività telomerasica Fisiologia dei telomeri La lunghezza media dei telomeri è : caratteristica di ciascun individuo ha una elevata ereditabilità è inversamente associata con l’età Ridotta dimensione dei telomeri Ridotta durata della Maggiore tasso di accorciamento vita degli organismi dei telomeri

7 Patologia dei telomeri Disfunzione dei telomeri Instabilità genomica Trasformazione oncogenica Apoptos i Malattie età correlate Malattie cardiovascolari Invecchiamento Nei tumori: Lunghezza dei telomeri minore della media nella fasi iniziali Elevata attività telomerasica negli stadi avanzati

8 SNP (single nucleotide polymorphism)= sostituzione nucleotidica polimorfica Esistono SNP in cui il cambiamento di una base determina la creazione o perdita di un sito di restrizione (RFLP=restriction fragment lenght polymorphism) Sia gli SNP che gli RFLP hanno 2 alleli La variabilità genetica

9 VNTR (variable number tandem repeats) STR (short tandem repeats) Minisatelliti o VNTR: ripetizioni lunghe 8-80bp Microsatelliti o STR: ripetizioni lunghe 2-7bp Numerosi alleli VNTR e STR

10 Il polimorfismo hTERT VNTR MNS16A MNS16A TCCTCTTAT CTCCTAGTCTCATC TCCTCTTATCATCTCCTAGTCTCATC

11 E’ stato osservato che la lunghezza degli alleli di MNS16A influenza l’attività del promotore, agli allele lunghi (L) è associata elevata attività del promotore dell’RNA antisenso e ridotta attività telomerasica e, viceversa agli alleli corti (S) è associata minore attività del promotore dell’RNA antisenso e maggiore attività telomerasica. Questo minisatellite si trova a valle dell'esone 16 del gene hTERT e a monte nella regione di un ipotetico promotore di un trascritto RNA antisenso di hTERT. L’osservazione di un RNA messaggero antisenso di hTERT ha suggerito una possibile regolazione della telomerasi umana. Gli alleli diversi sarebbero perciò associati a diversa funzionalità

12 Scopo dell’elaborato Esaminare la distribuzione del polimorfismo MNS16A di hTERT tramite tecniche standard di PCR in due popolazioni italiane Campione dell’Italia settentrionale: ~ 150 individui non imparentati, raccolto presso l’ospedale civile di Verona Campione dell’Italia meridionale: ~ 230 individui non imparentati, raccolto in una popolazione del Cilento

13 Genotipizzazione 1 e 10: marker 2:243, 3:274, 4:302, 5:333, 6:364 bp

14 Analisi delle sequenze

15 Gli alleli sono classificati in base al numero crescente di ripetizioni in tandem MNS16A VNTR-243 AGGATTCTGATCTCTGAAGGGTGGGTAGG GTGGGGCAGTGGAGGGTGTGGACACAGG AGGCTTCAGGGTGGGGCTGGTGATGCTCC CTCATCCTCTTATCATCTCCCAGTCTCATCT CTTATCCTCTTAT CTCCTAGTCTCATCC AGACTTACCTCCCAGGGCGGGTGCCAGGC TCGCAGTGGAGCTGGACATACGTCCTTCCT CAGGCAGA

16 Genotipizzazione 1 e 10: marker S < 300bp L > 300bp 2:243, 3:274, 4:302, 5:333, 6:364 bp

17 Analisi dei dati Frequenze genotipiche osservate nelle due popolazioni italiane Frequenze alleliche osservate

18 P (Hardy-Weinberg) > 0,05 non significativo per entrambe le popolazioni Frequenze genotipiche e alleliche Il test del chi quadrato di indipendenza mostra che le due popolazioni non sono diverse significativamente (p=0.3) S < 300bp L > 300bp

19 Confronto tra frequenze alleliche nella popolazione italiana Frequenze dell’allele L

20 Confronto tra frequenze alleliche nelle popolazioni europee Frequenze dell’allele L

21 Conclusioni Questi risultati rappresentano il punto di partenza per studi di associazione di MNS16A con la longevità e con la suscettibilità a malattie età correlate nella popolazione italiana. Infatti gli alleli L ed S sembra siano associati a attività telomerasica diversa, è possibile che il polimorfismo funzionale MNS16A possa essere coinvolto nell’invecchiamento e nella determinazione della durata della vita

22 Grazie per l’attenzione


Scaricare ppt "Il polimorfismo VNTR MNS16A del gene TERT della telomerasi umana nella popolazione italiana ELABORATO FINALE Facoltà di Scienze Matematiche, Fisiche e."

Presentazioni simili


Annunci Google