La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Dott.ssa Silvia Pellegrini Laboratorio Microarray Dipartimento di Patologia Sperimentale, Biotecnologie Mediche, Infettivologia ed Epidemiologia Tel. 050.

Presentazioni simili


Presentazione sul tema: "Dott.ssa Silvia Pellegrini Laboratorio Microarray Dipartimento di Patologia Sperimentale, Biotecnologie Mediche, Infettivologia ed Epidemiologia Tel. 050."— Transcript della presentazione:

1 Dott.ssa Silvia Pellegrini Laboratorio Microarray Dipartimento di Patologia Sperimentale, Biotecnologie Mediche, Infettivologia ed Epidemiologia Tel

2 Le scienze della vita sono attualmente al centro di una vera e propria rivoluzione

3 1953: modello di Watson e Crick

4 Progetto Genoma Umano

5 Genoma L’insieme di tutte le molecole di DNA presenti nel nucleo di ogni cellula Nell’uomo: 44 cromosomi autosomici 2 cromosomi sessuali

6 Struttura del DNA 2 2 2

7 nucleo cromosoma Doppia elica istoni Coppie di basi cellula

8 1 ccctgtggag ccacacccta gggttggcca atctactccc aggagcaggg agggcaggag 61 ccagggctgg gcataaaagt cagggcagag ccatctattg cttacatttg cttctgacac 121 aactgtgttc actagcaacc tcaaacagac accatggtgc acctgactcc tgaggagaag 181 tctgccgtta ctgccctgtg gggcaaggtg aacgtggatg aagttggtgg tgaggccctg 241 ggcaggttgg tatcaaggtt acaagacagg tttaaggaga ccaatagaaa ctgggcatgt 301 ggagacagag aagactcttg ggtttctgat aggcactgac tctctctgcc tattggtcta 361 ttttcccacc cttaggctgc tggtggtcta cccttggacc cagaggttct ttgagtcctt 421 tggggatctg tccactcctg atgctgttat gggcaaccct aaggtgaagg ctcatggcaa 481 gaaagtgctc ggtgccttta gtgatggcct ggctcacctg gacaacctca agggcacctt 541 tgccacactg agtgagctgc actgtgacaa gctgcacgtg gatcctgaga acttcagggt 601 gagtctatgg gacccttgat gttttctttc cccttctttt ctatggttaa gttcatgtca 661 taggaagggg agaagtaaca gggtacagtt tagaatggga aacagacgaa tgattgcatc 721 agtgtggaag tctcaggatc gttttagttt cttttatttg ctgttcataa caattgtttt 781 cttttgttta attcttgctt tctttttttt tcttctccgc aatttttact attatactta 841 atgccttaac attgtgtata acaaaaggaa atatctctga gatacattaa gtaacttaaa 901 aaaaaacttt acacagtctg cctagtacat tactatttgg aatatatgtg tgcttatttg 961 catattcata atctccctac tttattttct tttattttta attgatacat aatcattata 1021 catatttatg ggttaaagtg taatgtttta atatgtgtac acatattgac caaatcaggg 1081 taattttgca tttgtaattt taaaaaatgc tttcttcttt taatatactt ttttgtttat 1141 cttatttcta atactttccc taatctcttt ctttcagggc aataatgata caatgtatca 1201 tgcctctttg caccattcta aagaataaca gtgataattt ctgggttaag gcaatagcaa 1261 tatttctgca tataaatatt tctgcatata aattgtaact gatgtaagag gtttcatatt 1321 gctaatagca gctacaatcc agctaccatt ctgcttttat tttatggttg ggataaggct 1381 ggattattct gagtccaagc taggcccttt tgctaatcat gttcatacct cttatcttcc 1441 tcccacagct cctgggcaac gtgctggtct gtgtgctggc ccatcacttt ggcaaagaat 1501 tcaccccacc agtgcaggct gcctatcaga aagtggtggc tggtgtggct aatgccctgg 1561 cccacaagta tcactaagct cgctttcttg ctgtccaatt tctattaaag gttcctttgt 1621 tccctaagtc caactactaa actgggggat attatgaagg gccttgagca tctggattct 1681 gcctaataaa aaacatttat tttcattgca atgatgtatt taaattattt ctgaatattt 1741 tactaaaaag ggaatgtggg aggtcagtgc atttaaaaca taaagaaatg atgagctgtt 1801 caaaccttgg gaaaatacac tatatcttaa actccatgaa agaaggtgag gctgcaacca 1861 gctaatgcac attggcaaca gcccctgatg cctatgcctt attcatccct cagaaaagga 1921 ttcttgtaga ggcttgattt gcaggttaaa gttttgctat gctgtatttt acattactta 1981 ttgttttagc tgtcctcatg aatgtctttt cactacccat ttgcttatcc tgcatctctc 2041 tcagccttga ct // gene della beta-globina umana Il contenuto di informazioni del DNA umano è dato dall’alternanza di 4 lettere A, G, T, C

9

10 Flusso delle informazioni genetiche

11 Il codice genetico

12 Alcuni dati sul genoma umano  3 miliardi di paia di basi  2% codificanti  Circa geni diversi  Più di 10 milioni di variazioni

13 Non siamo tutti uguali…

14 Non esiste un’unica sequenza del genoma umano, ma circa il 10% dei 3 miliardi di paia di basi che compongono il genoma umano variano da individuo a individuo e costituiscono dei polimorfismi genetici.

15 I. Single Nucleotide--SNPs G A II. “indel” (inserzioni/delezioni) TGACG TG Variable Number of Tandem Repeats Polimorfismi genetici Forme alleliche diverse di una stessa sequenza presenti in più dell’1% degli individui di una popolazione

16 SNP (Single Nucleotide Polymorphism) Polimorfismi a singolo nucleotide ovvero cambiamenti di una base

17 Una sequenza di DNA di 60 basi in 25 soggetti diversi

18 SNPs Variazioni di sequenza comuni Possono avere un significato funzionale diretto –Aumento dell’attività della proteina –Diminuzione dell’attività della proteina Possono essere semplicemente associati ad altre variazioni di sequenza con significato funzionale Possono essere silenti

19 Variazioni di una base nella regione codificante di un gene portano ad un’alterazione della sequenza aminoacidica della proteina corrispondente con possibile cambiamento funzionale

20 globuli rossi a falce GAA > GAG Glu > Val Esempio di variazione di una sola base di tipo causativo anemia a cellule falciformi Hb-AHb-S

21 Molto più complicato è il caso delle malattie multifattoriali causate dall’alterazione di più geni che agiscono in concomitanza con numerosi fattori ambientali

22

23 In questo caso le alterazioni geniche rappresentano fattori di suscettibilità, ciascuno dei quali contribuisce in una certa misura alla malattia, che si manifesterà soltanto quando i fattori di rischio nel loro insieme (geni e ambiente) superano una data soglia

24

25 ApoE ε2 GACGTGTGCGGCCGC……CAGAAGTGCCTGGCA ApoE ε3 GACGTGTGCGGCCGC……CAGAAGCGCCTGGCA ApoE ε4 GACGTGCGCGGCCGC……CAGAAGCGCCTGGCA ApoE ε2 CysCys ApoE ε3 CysArg ApoE ε4 ArgArg ApoE e malattia di Alzheimer

26 n = (184)(138) (104) (64) (91) n = (79) (3) (57) (26) (29) “s” genotype (n = 581) “l” genotype (n = 264) Groups of individuals having different numbers of life events Major depression episodes (%)

27 I polimorfismi possono essere responsabili di una diversa suscettibilità alle malattie…

28 …come pure della variabilità individuale nella risposta alla terapia farmacologica

29 paziente gusto Farmaco giusto dose giusta Esamina le varianti genetiche che determinano la risposta ad un farmaco e studia il modo in cui queste varianti possono essere usate per prevedere il tipo di risposta Farmacogenetica

30 Selezione sulla base di fattori predisponenti alle malattie diagnosi precoce Selezione sulla base di fattori responsabili di una diversa risposta al trattamento Terapia personalizzata

31 A caccia di alleli di suscettibilità CCGGTTCCTTAAGGGGGGTTGGTTAAAATTCC

32 Studi di associazione casi-controlli Popolazione senza malattia AATTCCCCGGAAGGTTCCTTAAAAGGGGTTGG CCGGTTGGTTAAAACCTTCCTTAAGGGGTTGG SNP Popolazione con malattia

33 Gene A Malati Controlli sani Nessuna variante del gene (verde o nera) è associata con la malattia

34 Gene B Malati Controlli sani La variante rossa del gene è associata con la malattia Questo tipo di analisi può essere fatto senza conoscere la funzione del gene

35 Selezione delle due popolazioni devono differire solo per il fenotipo di interesse devono essere il più omogenee possibile per tutti gli altri aspetti (sesso, età, etnia…) non devono esserci stratificazioni all’interno (= sottogruppi diversi) devono essere sufficientemente numerose (la numerosità del campione per rilevare associazioni statisticamente significative dipende dalla frequenza degli SNP studiati)

36 Whole genome scans Single SNP analysis Genotyping of candidate genes and SNPs

37 da Nature 426, (2003 ) L’utilizzo degli aplotipi può facilitare l’analisi

38 HapMap project

39 Il futuro: l’intero assetto genetico su un chip grande come una carta di credito

40 La necessità di un approccio informatico alla ricerca nel settore biomedico deriva da questa recente esplosione di informazioni biologiche generate dalla comunità scientifica

41 BIOINFORMATICA Disciplina situata all’interfaccia tra informatica e scienze biologiche (quali la biologia molecolare e la genetica) che applica algoritmi informatici per la risoluzione di problemi biologici

42 Questa quantità enorme di informazioni è conservata e resa disponibile per l’intera comunità scientifica da tre organismi principali

43 NCBI = National Center for Biotechnology Information EMBL = European Molecular Biology Laboratory KEGG =Kyoto Encyclopedia of Genes and Genomes  creano Database di pubblico accesso  diffondono informazioni biomediche  sviluppano software per l’analisi di dati


Scaricare ppt "Dott.ssa Silvia Pellegrini Laboratorio Microarray Dipartimento di Patologia Sperimentale, Biotecnologie Mediche, Infettivologia ed Epidemiologia Tel. 050."

Presentazioni simili


Annunci Google