La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Dott. Michele Polli Università degli Studi di Milano Facoltà di Medicina Veterinaria di Milano Istituto di Zootecnica via Celoria 10 - Milano ANALISI DEL.

Presentazioni simili


Presentazione sul tema: "Dott. Michele Polli Università degli Studi di Milano Facoltà di Medicina Veterinaria di Milano Istituto di Zootecnica via Celoria 10 - Milano ANALISI DEL."— Transcript della presentazione:

1 Dott. Michele Polli Università degli Studi di Milano Facoltà di Medicina Veterinaria di Milano Istituto di Zootecnica via Celoria 10 - Milano ANALISI DEL DNA: APPLICAZIONI PER LA SELEZIONE DEL CANE DI RAZZA

2 o CONTROLLO GENETICO DELLA PARENTELA o STUDIO DELLA VARIABILITA GENETICA o STUDIO DELL EREDITA PATOLOGICA E SELEZIONE PER CARATTERI MORFOLOGICI DI INTERESSE SELEZIONE DEL CANE DI RAZZA: GENETICA MOLECOLARE APPLICAZIONE DELLE TECNICHE DEL DNA ALLA SPECIE CANINA Applicazioni principali :

3 CONTROLLO GENETICO DELLA PARENTELA NEL CANE ANALISI DEI MICROSATELLITI A LIVELLO DEL DNA SEQUENZE DI RIPETIZIONI CONTIGUE DINUCLEOTIDI (CA) 2 TRINUCLEOTIDI (GAT) 3 TETRANUCLEOTIDI (GAAA) 4 FREQUENZA E POLIMORFISMO SI TRASMETTONO IN MODO MENDELIANO Valorizzazione del libro genealogico

4 Sequenziamento con isotopi radioattivi a = adenina c = citosina g = guanina t = timina g t a c g t a c MICROSATELLITE ripetizione: adenina e citosina acacacacacacacacacacacacacacac dinucleotide :(ac) 15

5 Sangue Peli Seme 1) ESTRAZIONE DEL DNA Doppia Elica DNA Individuo AIndividuo BIndividuo Ccampione di controllo 3 paia di cromosom i omologhi 2) PCR Polymerase Chain Reaction 3) ELETTROFORESI

6 Sequenziatore Automatico Immagine Computerizzata dell elettroforesi Elettroferogramma di un campione con 12 microsatelliti PADRE MADRE FIGLIO GENOTIPO: 263/263 GENOTIPO: 263/277 GENOTIPO: 263/263 DIAGNOSI POSITIVA Profilo genetico di un campione

7 MADRE FIGLIO PADRE FIGLIO GENOTIPO: 263/277 GENOTIPO: 263/ MADRE FIGLIO PADRE FIGLIO GENOTIPO: 128/140 GENOTIPO: 128/146 GENOTIPO: 128/128 GENOTIPO: 124/128 GENOTIPO: 128/ DIAGNOSI POSITIVA DIAGNOSI NEGATIVA

8 PADRE MADRE FIGLIO GENOTIPO: 105/111 GENOTIPO: 99/105 GENOTIPO: 111/111 GENOTIPO: 105/ DIAGNOSI NEGATIVA

9 ENCI ALLEVATORI ISTITUTO DI ZOOTECNICA CONTROLLO DELLA PARENTELA PRIVATI POLIZIA TRIBUNALE

10 DIAGNOSI DI PARENTELA PER ENCI 106 RICHIESTE anno 2000 (controllo di 106 gruppi famigliari) Per vizi di forma nelliscrizione delle cucciolate Contestazioni e denunce di alcuni allevatori n 78 DIAGNOSI NON ESEGUITE n I cani non sono stati sottoposti al test del DNA e quindi non sono stati iscritti al libro genealogico n Costi elevati ? n Scetticismo e delusione ? n Difficoltà logistiche ? n disinformazione ? n dubbio sulleffettiva parentela ? n 28 DIAGNOSI ESEGUITE n I cani sono stati sottoposti al test del DNA e quindi sono stati iscritti al libro genealogico n Prelievi ematici presso n Università n Asl n Liberi Professionisti n Controllo del Tatuaggio o microchip n Certificazione del Veterinario e autocertificazione dellallevatore n 28 DIAGNOSI ESEGUITE n I cani sono stati sottoposti al test del DNA e quindi sono stati iscritti al libro genealogico n Prelievi ematici presso n Università n Asl n Liberi Professionisti n Controllo del Tatuaggio o microchip n Certificazione del Veterinario e autocertificazione dellallevatore

11 NUMERO SOGGETTI ANALIZZATICUCCIOLIDIAGNOSI% % PADRE- MADRE- CUCCIOLIANALIZZATIPOSITIVA NEGATIVA ENCI % 1110% PRIVATI %2656% TOTALE % 37 23% CUCCIOLI ANALIZZATI DIAGNOSI POSITIVA DIAGNOSI NEGATIVA DIAGNOSI PER ENCIDIAGNOSI PER PRIVATI N°113N°102 N°11 N°47N°21N°26 44% 56% 90% 10%

12 PROBABILITA DI ESCLUSIONE DELLA PARENTELA ERRATA: EFFETTO CUMULATIVO Aumentando il numero dei microsatelliti analizzati aumenta la probabilità di esclusione di una parentela errata MICROSATELLITI PASTORE BERGAMASCO BOLOGNESE BRACCO ITALIANO CIRNECO DELL'ETNA CORSO PASTORE FONNESE LAGOTTO PASTORE MAREMMANO SEGUGIO ITALIANO SPINONE ITALIANO VOLPINO ITALIANO DOBERMANN PASTORE TEDESCO AKITA-INU

13 CON IL SISTEMA DEI MICROSATELLITI PER IL CONTROLLO DELLA PARENTELA LA DIAGNOSI NEGATIVA DI PARENTELA E SICURA AL 100 % L ATTRIBUZIONE DI PARENTELA E IN TERMINI PROBABILISTICI ED E IN RELAZIONE AL NUMERO DI MICROSATELLITI ANALIZZATI n ISTITUTO DI ZOOTECNICA: n 10 Microsatelliti di base ( tra più informativi) n 12 Microsatelliti di riserva n L attribuzione della parentela in tutte le principali razze esaminate è del 99,9 %

14 1) Razze Italiane: Pastore Bergamasco Bolognese Cane Corso Pastore Fonnese Lagotto Levriero Italiano Pastore Maremmano Segugio Italiano Spinone Italiano Volpino Italiano Bracco Italiano Cirneco dellEtna BIODIVERSITA NELLA SPECIE CANINA Studio delle relazioni genetiche e della variabilità genetica mediante microsatelliti 2) Razze Estere: Dobermann Pastore Tedesco Akita-Inu Alano Bassotto Lupo Cecoslovacco Obiettivi: - Distanze genetiche e relazioni genetiche tra razze canine e altri canidi - Polimorfismo (variabilità genetica) - Consanguineità Metodo: - Microsatelliti del DNA - Analisi del DNA di soggetti non imparentati in seconda generazione 3) Altro : Pastore Fonnese Lupo Dabruzzo Volpe

15 MICROSATELLITI POLYMORPHISM INFORMATION CONTENT (PIC) RELATIVO AD OGNI RAZZA ED A OGNI MICROSATELLITE AKITA-INUPASTORE BERGAMASCO BOLOGNESE PASTORE FONNESE DOBERMANN SPINONE PASTORE MAREMMANO PASTORE TEDESCO CORSO LAGOTTO SEGUGIO

16 BREEDS PASTOREBOLOGNESEBRACCOCIRNECOCORSOPASTORELAGOTTOPASTORE SEGUGIOSPINONEVOLPINO BERGAMASCOITALIANODELL'ETNAFONNESEMAREMMANOITALIANO MICRO.PIC % ATH 1210,5520,8330,6910,7940,8820,8530,7180,7910,8050,5190,828 alleles CXX 1230,7380,7260,6640,6370,7690,7630,560,7250,7220,6280,721 alleles CXX 2630,8460,770,7940,8020,5370,7390,510,8580,8450,7560,788 alleles CXX 4030,8060,6620,7290,7380,6140,7670,3730,6480,8120,5970,749 alleles CXX21370,6490,760,4480,7530,80,7510,8090,8490,7430,8260,788 alleles CXX21380,7890,650,7170,5030,5040,8640,7610,8480,8050,8460,825 alleles CXX21590,7960,8610,4950,6780,7750,8010,8530,8840,8540,5960,765 alleles CXX 200,3710,5520,1090,6370,50,6210,4420,7480,5150,6280,652 alleles CXX20010,7090,7280,6160,7010,8470,4870,640,8050,7330,6370,743 alleles CXX21320,8060,8630,7790,6910,8810,7610,7670,870,8220,4410,87 alleles pic X0,7060,740,6040,6930,710,740,6430,8020,7650,6470,762 Polymorphism Information Content (PIC) e numero di alleli in alcune razze canine italiane

17 -2,00 -0,33 -1,33 -3,00 PRIN3 -0,83 -0,36-1,56-2,76 -1,33 -0,27 0,79 1,84 MAREMMANO VOLPE CORSO CIRNECO BOLOGNESE SEGUGIO BERGAMASCO P.TEDESCO P.CECOSLOVACCO LUPO DOBERMANN ANALISI DELLE COMPONENTI PRINCIPALI

18 IDENTIFICAZIONE DEI GENI RESPONSABILI DELLE PRINCIPALI MALATTIE EREDITARIE: EREDITA PATOLOGICA o MAPPAGGIO DEL GENOMA: »localizzazione di tutte le sequenze che costituiscono il genoma o Obiettivo finale »Contare e localizzare tutti i geni sui cromosomi prima di determinarne la funzione o Applicazione principale nel cane è quella di sviluppare dei test diagnostici per le principali malattie ereditarie o per identificare i geni responsabili per determinati fenotipi

19 STRATEGIE DI STUDIO: MALATTIE MONOGENETICHEMALATTIE POLIGENETICHE MAPPAGGIO DEL GENOMA NEL CANE MAPPE FISICHE MAPPE GENETICHE (linkage) MAPPE COMPARATIVE TECNICHE PRINCIPALI: PCR (Polimerase Chain Reaction) SEQUENZIAMENTO codice genetico: es: aattcgattttaggccca ANALISI DI LINKAGE Identificazione di marcatori che segregano con i geni di interesse responsabili per la malattia genetica in studio Marcatore Geni GENOMA RICERCA DEL GENE CANDIDATO: Individuare i possibili geni candidati responsabili della malattia Studi Fisiologici e biologici Studi di patologie similari in altre specie Individuare il polimorfismo del gene candidato e controllo sul pedigree

20 1,2 1,1 2,2 1,1 1,2 SEGREGAZIONE TRA MICROSATELLITE E MALATTIA ASSENZA DI SEGREGAZIONE TRA MICROSATELLITE E MALATTIA PRINCIPIO DI UN TEST GENETICO GAMETI RICOMBINANTI non cè stata separazione tra gli alleli a 1a d = 0 cM a 1a Microsatellite Gene mutante GAMETOGENESI CROSSING-OVER MEIOTICO malato portatore sano monogenica dominante monogenica recessiva Genotipi Microsatellite

21 ATTGTATACNATCATATAGGCGAATCGAGCTCGGTAC CGGGGATCCTCTAGATCGACCTGCANGCATGCAAGC TTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGT AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTA TCCGCTCACAATTCCACACAACATACGAGCCGGAAGC ATAAAGTGT AAAGCCTGGGGTG CCTAATGAGTGA GCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGC TTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAA TGAATCGGCCAACGCGCGGGGAAAAGCGGTTTGCGT ATTGGGCGCTCTTCCCGCTTCCTCCGCTCACTGACTCC CTGCGCTCGGTCCTTCCGCTTGCGGCGAACGGTATCA CTCACTCCNAAAGCGGTAATACNGTTATCCACAAAAT CCAGGGGAATAACGCCAGAAAAAACATTTTAACCAA AAGGCCACCAAAGGCCAGAACCCTTAAAAGCcGCGTT GCTGCTTTTTCCCCATAGCTCCCCCCCCCCGAACAACA TCCACNAAATCCACCTCCATTTCAAAGTTTGGAAN ATTGTATACNATCATATAGGCGAATCGAGCTCGGTAC CGGGGATCCTCTAGATCGACCTGCANGCATGCAAGC TTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGT AATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTA TCCGCTCACAATTCCACACAACATACGAGCCGGAAGC ATAAAGTGT AAAGCCTGAACTG CCTAATGAGTGAG CTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTT TCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATG AATCGGCCAACGCGCGGGGAAAAGCGGTTTGCGTAT TGGGCGCTCTTCCCGCTTCCTCCGCTCACTGACTCCCT GCGCTCGGTCCTTCCGCTTGCGGCGAACGGTATCACT CACTCCNAAAGCGGTAATACNGTTATCCACAAAATCC AGGGGAATAACGCCAGAAAAAACATTTTAACCAAAA GGCCACCAAAGGCCAGAACCCTTAAAAGCcGCGTTGC TGCTTTTTCCCCATAGCTCCCCCCCCCCGAACAACATC CACNAAATCCACCTCCATTTCAAAGTTTGGAAN SEQUENZIAMENTO

22 MALATTIE GENETICHE o Esistono più di 370 malattie genetiche o Attualmente sono disponibili circa 20 test del DNA o Lo studio del DNA permette il riconoscimento della malattia (geni mutanti) indipendentemente dalla sua manifestazione fenotipica o Controllo genetico della parentela TEST DEL DNA ATTUALMENTE DISPONIBILI o TEST BASATI SUL RICONOSCIMENTO DEL GENE MUTANTE o TEST BASATI SUL RICONOSCIMENTO DI UN MARCATORE (Microsatellite) CORRELATO AL GENE MUTANTE o TEST BASATI SUL RICONOSCIMENTO DEI GENI RESPONSABILI PER UNA PARTICOLARE COLORAZIONE DEL MANTELLO

23 TEST BASATI SUL RICONOSCIMENTO DEL GENE MUTANTE von Willebrand's Disease- Scottish Terrier Phosphofructokinase Deficiency - Springer Spaniel Phosphofructokinase Deficiency - Cocker Spaniel Progressive Retinal Atrophy - Irish Setter Pyruvic Kinase Deficiency - Basenji von Willebrand's Disease - Doberman Pinscher von Willebrand's Disease - Shetland Sheepdog von Willebrand's Disease - Manchester Terrier von Willebrand's Disease - Poodle (all) von Willebrand's Disease - Pembroke Welsh Corgi Congenital stationary night blindness- Briard Globoid leukodystrophy- W. H. White Terriers Cystinuria- Newfoundland

24 TEST BASATI SUL RICONOSCIMENTO DI UN MARCATORE (Microsatellite) CORRELATO AL GENE MUTANTE Copper Toxicosis - Bedlington Terriers Progressive Retinal Atrophy- Cocker Spaniel Progressive Retinal Atrophy- Labrador retriever Progressive Retinal Atrophy- Portuguese water dog Progressive Retinal Atrophy- Chesapeake Bay retriever Renal Dysplasia - Shih Tzu Renal Dysplasia - Lhasa Apso Renal Dysplasia - Soft Coated Terrier Tests for presence of chocolate & yellow -Labrador Retriever Tests for presence of red -Doberman Pinscher Tests for presence of black, brown, buff/red-American Cocker Spaniel Tests for presence of black, liver and yellow -Flat-coated Retriever Tests for presence of cream, white, red and apricot -Poodle (all varieties) Tests for presence of - brindle and wheaten -Scottish Terrier Tests for presence of - brindle -Scottish Terrier Tests for presence of - wheaten-Scottish Terrier TEST BASATI SUL RICONOSCIMENTO DEI GENI RESPONSABILI PER UNA PARTICOLARE COLORAZIONE DEL MANTELLO Coat Color Tests

25 Airedale Terrier.... Alaskan Malamute.... All not listed in description.... American Cocker Spaniel... Australian Shepherd.... Beagle.... Bernese Mountain Dog.... Boston Terriers.... Bullmastiff.... Collie.... Dalmatian.... English Springer Spaniel.... German Shepherd... Golden Retriever... Irish Setter.... Labrador Retriever.. Miniature Schnauzer.... Newfoundland.... Poodle... Portuguese Water Dog... Rottweiler.... Shetland Sheepdog.... Vizla.... West Highland White Terriers.... PRINCIPALI MALATTIE GENETICHE IN STUDIO RAZZE Early Onset (or Juvenile) Cataract Progressive Retinal Atrophy Canine Hip Dysplasia Inherited Epilepsy von Willebrand' Disease

26 CONCLUSIONI o Il test di parentela nel cane di razza deve essere applicato in modo più efficace anche in Italia o I test del DNA relativi alle malattie ereditarie, i test basati sul riconoscimento delle varianti alleliche utili per determinati fenotipi e lo studio della variabilità genetica devono diventare uno strumento di selezione per il cane di razza sempre più diffusi nella pratica veterinaria


Scaricare ppt "Dott. Michele Polli Università degli Studi di Milano Facoltà di Medicina Veterinaria di Milano Istituto di Zootecnica via Celoria 10 - Milano ANALISI DEL."

Presentazioni simili


Annunci Google