La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,

Presentazioni simili


Presentazione sul tema: "La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,"— Transcript della presentazione:

1 La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo, Pavia

2 Le malattie cardiovascolari rappresentano la più importante causa di morbidità e mortalità Cardiopatia ischemica: acuta e cronica Scompenso Aritmie Ipertensione Stroke Vasculopatie periferiche

3

4 La genetica classica: si rivolge alla trasmissione dei tratti/caratteri: anamnesi familiare misura di parametri biochimici Per cardiopatia ischemica Per vasculopatia aterosclerotica Per fattori di rischio: Colesterolemia, glicemia, ipertensione, omociteinemia, ipercoagulabilità

5 Familiarità evidence-based Deve essere documentata: –Da report ancora disponibili –Da diagnosi ottenute in ambiente ospedaliero –Da referti autoptici Se non è documentata o attendibile è opportuno segnalarne lincertezza

6 Familiarità Evidence-based Nonni: dati sulle cause di decesso devono essere documentati Genitori: –Contestualizzare il periodo degli eventi riferiti, la sede in cui sono stati osservati o si sono verificati, chi e come li ha diagnosticati Fratelli/sorelle: –Molto più attendibile rispetto a quella dei genitori, anche se solo riferita

7 Costruire lalbero geneaologico: tradurre graficamente la storia della famiglia E graficamente utile E appropriata una rappresentazione grafica di malattie multifattoriali in modo analogo a quello delle malattie monogeniche? Non esitono malattie multifattoriali definibili autosomiche dominanti o recessive o legate allX, o matrilineari come le malattie monogeniche

8 Costruire lalbero genealogico Esistono malattie metaboliche monogeniche che correttamente possono essere rappresentate con alberi classici: FH Alcune forme di diabete Ipertensione arteriosa in sindromi precise

9 Lanamnesi familiare e gli alberi genealogici Coppie di fratelli

10 Paziente deceduto in ospedale con diagnosi accertata di infarto alletà di 51 anni Deceduto a domicilio improvvisamente a 62 anni Paziente di 49 anni Che si presenta con Angina instabile Lanamnesi familiare e gli alberi genealogici

11 Paziente deceduto in ospedale con diagnosi accertata di infarto alletà di 51 anni Deceduto a domicilio improvvisamente a 62 anni Paziente di 49 anni Che si presenta con Angina instabile Ipertensione NIDDM Ipertensione Fumo

12 morto di cuore Abbastanza giovane Morto di ca polmonare Ma soffriva di cuore Aveva il colesterolo Hanno il colesterolo I cugini vivono in unaltra città Non ci vediamo da tempo Lanamnesi familiare e gli alberi genealogici

13 IMA SCC POST-ISCHEMICO 30aa SD26aa, Rottura di cuore 38aa, ictus

14 Fenotipo del nonno: alto, magro, con le mani lunghe, aveva tutti i vasi chiusi Dissecazione Ao a 59 aa Ipercolesterolemia a 61 aa 59aa 55aa cancro IMA a 56 aa Iperomocisteinemia con mut. MTHFR

15 IMA; 48aa SD; 53aaIMA; 48aa La familiarità può essere derivata da entrambi i genitori

16 Genetica molecolare Geni Analisi Sequenza Varianti alleliche polimorfismi: >1% Distribuzione nella popolazione

17 Malattie monogeniche vs malattie multifattoriali, complesse In una malattia monogenica, il difetto è suff. per causare il fenotipo In una malattia multifattoriale devono combinarsi gli effetti prodotti da più fattori genetici e da fattori esogeni/ambientali: ciascun fattore è contributore ma non suff. a generare il fenotipo

18 Genes and CAD RAS Coagulation cascade Cholesterol Diabetes Inflammations Adrenergic receptors Hypertension aging

19 La maggior parte degli studi disponibili è di tipo caso-controllo Primo studio: Cambien 1992: polimorfismo ACE ID controlla circa il 50% dei livelli circolanti di ACE Da quel primo studio, centinaia di altri studi condotti sul genotipo ID del gene dellACE Nessuno è risultato conclusivo Largomento è ancora oggetti di ricerca

20 Metabolismo lipidico Malattie monogeniche: ipercolesterolemia familiare da difetto del recettore LDL Dislipidemie combinate Difetti legati alle lipoproteine Lp(a)

21 Metabolismo lipidico Fattori geneticamente determinati Fattori esogeni: dieta, stili di vita

22 Ipercolesterolemia familiare

23 INTERMEDIATE PHENOTYPE: > LDL cholesterol Ultimate phenotype CAD Genotypes LDL cholesterol: Apo-B, Apo-E Exogenous factors diet, life style

24 LDL cholesterol: gene variants Apo-B gene –XbaI, EcoRI, in CAD –MspI: OR 1.18; 95%CI: (Atherosclerosis, 1998;141: Apo-E gene –Polimorphisms 2, 3, 4: 2 ApoE, Total Cholesterol, and HDL Cholesterol

25 ApoE Isoforms: isoelectic focusing E2(0), E3(+1), E4(+2) Epsilon2: --->Arg158Cys Lys156Gln Arg145Cys Arg136Ser Epsilon4:Arg158Cys

26 ApoE: Epsilon4 - Risk of CAD Independent on age and LDL cholesterol OR: from 1.26 in metanalysis of 6355 pts to 2.74 in a small japanese population In families and twins: low HDL cholesterol: 35-50% genetic contribution and risk of early CAD

27 ApoE gene Polymorphisms CAD Alzheimer S Creutzfeld-Jacob S Familial amyloidotic polyneuropathy Down Syndrome Vascular dementia Age-related memory decline Autosomal dominant amyotrophic lateral sclerosis Schizophrenia Hungtington D Fetal Iodin Deficiency disorder (endemic cretinism9 You are epsilon 4: Make your choice

28 Paraoxonase Paroxonase: shows clear-cut mendelian polymorphism, is an arylesterase, arylesterase activity, measured with phenylacetate as substrate, is determined by the same locus as paraoxonase. both activities are expressed by a single enzyme. Protects against CAD by destroying proinflammatory oxidized lipids in LDL Disorders: –Cystic fibrosis –Detoxification of organophosphate insecticides –CAD

29 Paraoxonase deficient mice Unable to prevent LDL oxidation in cocoltured cell model of the arterial wall Effects on both LDL and HDL isolated from PON 1 KO mice

30 Gln191Arg Met54Leu regulatory region Paraoxonase genotypes ---> different enzymatic activity: Gln191Arg: rapid hydrolization, lower activity (22.8%), > vulnerability to toxic agents Linkage disequilibrium

31

32

33 Arch Intern Med 2001 Jul 9;161(13): Hyperhomocystinemia: a risk factor or a consequence of coronary heart disease? Knekt P, et al. This prospective study does not support the hypothesis that a high concentration of serum homocysteine is a risk factor for coronary events in a population free of heart disease. However, it does suggest that mild hyperhomocystinemia predicts secondary coronary events in men with heart disease, possibly as a consequence of atherosclerotic changes.

34 J Am Coll Cardiol 2001 Jun 1;37(7): A randomized double-blind placebo-controlled trial of the effect of homocysteine-lowering therapy with folic acid on endothelial function in patients with coronary artery disease. Thambyrajah J et al.

35 Homocysteine: sulfur-containig, non- proteinogenic AA biosynthesized from methionine: To be remethylated to methionine To enter the Cys biosynthetic pathway To be released into extracellular medium

36 protein damage

37 Homocysteine Induces Expression and Secretion of Monocyte Chemoattractant Protein-1 and Interleukin-8 in Human Aortic Endothelial Cells Circulation 2001;103:2717

38 Homocysteine Induces Expression and Secretion of Monocyte Chemoattractant Protein-1 and Interleukin-8 in Human Aortic Endothelial Cells Circulation 2001;103:2717

39 Hyperhomocysteinemia Folate and cobalamine deficiency Pregnancy complications Rheumatoid artritis CRF, dyalisis, renal transplant Inflammatory bowel disease Diabetes mellitus and Insulin resistance syndrome Neuronal tube defects Mental disorders Cognitive impairment in elderly Psoriasis Tumors CV diseases

40 VII VIIa VIIa / TF TF XI XIa T IX IXa VIIIVIIIa T IXa / VIIIa XXa VaV T Xa / Va IIIIa fibrinogeno fibrina MT M. Tubaro, Corso ANMCO di Epidemiologia Genetica

41 Polimorfismo f. VII Iacoviello L, N Engl J Med 1998;338:79-85 R 353 Q: RR / RQ / QQ Regione ipervariabile 4: H7H7 / H6H7/ H6H6 / H7H5 / H6H5 0 diminuito 1 aumentato 10 rischio di IMA RQH6H6 RRH6H7 RQH6H7 RRH7H7 RQH7H7 QQH7H f. VII act. RR QQ H6H6 H7H7 *** ** M. Tubaro, Corso ANMCO di Epidemiologia Genetica

42 C C * * * RGD * * NN Pl A1 Pl A2 (Leu 33 Pro) Pen a Pen b (Arg 143 Glu) Ca ++ dodecapeptide ( ) * Bak a Bak b (Ser 843 Ile) CA (Arg 489 Glu) Sr (Arg 636 Cys) Gp IIb/IIIa Mo Pro 406 Ala M. Tubaro, Corso ANMCO di Epidemiologia Genetica

43 Metanalisi dellassociazione tra polimorfismo Pl A2 e IMA Zhu MM Am J Cardiol 2000; 86: confronto studi pz OR pooled (95% CI) p Pl A2A2/A1A2 vs Pl A1A ( ) 0.2 Pl A2A2 vs Pl A1A ( ) 0.5 Pl A2A2 vs Pl A1A2/A1A ( ) 0.4 M. Tubaro, Corso ANMCO di Epidemiologia Genetica

44 PAI-1 4 G ACACGTGGGGACTCAG attivatore aumento della velocità di trasmissione 5 G ACACGTGGGGGACTCAG attivatore normale velocità di trasmissione REPRESSORE le citochine infiammatorie o i lipidi plasmatici (TGC, VLDL), in presenza del genotipo 4G/4G, aumentano ulteriormente la produzione di PAI-1 M. Tubaro, Corso ANMCO di Epidemiologia Genetica

45 Metanalisi del polimorfismo 4G/5G del PAI-1 Iacoviello L. Thromb Haem 1998;80: Studi retrospettivi caso-controllo in popolazioni a basso rischio Studi prospettici caso-controllo in popolazioni a basso rischio Studi retrospettivi caso-controllo in popolazioni ad alto rischio totale M. Tubaro, Corso ANMCO di Epidemiologia Genetica

46 Varianti alleliche in geni codificanti per citochine, mediatori della flogosi crescente ruolo delle citochine e dei mediatori della risposta infiammatoria nella patogenesi della cardiopatia ischemica TNF, TNFreceptor, IL8, RANTES, MCP1, etc. Ogni gene codificante per un fattore di flogosi è un potenziale candidato.

47 Laterosclerosi è una malattia infiammatoria Chemokines I meccanismi biologici che la governano sono quelli della flogosi

48 La complessa rete del sistema di interazione cellulare nella flogosi

49 MCP-1 gene regulatory region at : MWM; 2: G/G; 3: A/G; 4: A/A. RANTES pm region. 1:MWM; 2: R -403 A/A; 3: R -403 G/A; 4: R -403 G/G; 5; R -28 G/G; 6; R -28 C/G; 7: R -28 C/C; Inflammation mediators

50 Extracellular 2AR: small MW ligands bind to sites within the hydrophobic core formed by TM -helices. Belongs to a major subfamily of CPCR: signal transduction

51 Genotype Frequency Distributions and Allele Frequencies of the Ser49Gly and Gly389Arg Polymorphisms of the ß1-Adrenergic Receptor Gene in Controls and Hypertensives Categories Controls (n=265), n (%)Hypertensives (n=292), n (%)P Arg389Gly Arg/Arg134 (50.6)192 (65.8) Gly/Arg110 (41.5)86 (29.5)... Gly/Gly21 (7.9)14 (4.8)... Arg378 (71.3)470 (80.5) Gly152 (28.7)114 (19.5)... Ser49Gly Ser/Ser193 (72.8)199 (68.2)... Ser/Gly66 (24.9)81 (27.7)... Gly/Gly6 (2.3)12 (4.1)0.31 Ser49452 (85.3)479 (82)... Gly4978 (14.7)105 (18)0.14

52 Genetica e Ipertensione Ricerca di Geni Candidati 5. ADDUCINA (ADD) – Proteina eterodimerica della membrana cellulare che regola il trasporto ionico agendo sullactina del citoscheletro: favorisce il legame spectrina-actina mediato dalla calcio- calmodulina. – Subunità ( ADD1, 4p16.3 ) e subunità ( ADD2, 2p14-p13 ). – Cusi D et al., Lancet 1997 : linkage tra locus ADD1 e ipertensione essenziale. – Schork NJ et al., Am J Hypertens 2000; Bray MS et al., Am J Hypertens 2000; Ranade K et al., Am J Hypertens 2000; Province MA et al., Am J Hypertens 2000; Barlassina C et al., Am J Hypertens 2000; Boerwinkle E. Am J Hypertens 2000; Bianchi G and Cusi D. Am J Hypertens 2000 : influenza del polimorfismo Gly460Trp di ADD1 sui livelli di pressione arteriosa e sulla presenza di ipertensione arteriosa in popolazione di diverse etnie: suggerita associazione della variante allelica 460Trp con ipertensione in alcune popolazione e in altre no. A. Repetto, Corso ANMCO di Epidemiologia Genetica

53 Genetica e Ipertensione Risultati promettenti da studi di linkage e di associazione ma necessarie ulteriori indagini. Inconsistenza e difficile riproducibilità di alcuni risultati confermano ulteriormente la complessità del disordine. A. Repetto, Corso ANMCO di Epidemiologia Genetica

54 Genetica e Ipertensione IPERTENSIONE ARTERIOSA = MALATTIA DELLE ARTERIE DANNO DORGANO FENOTIPO INTERMEDIO come indice importante di diagnosi precoce A. Repetto, Corso ANMCO di Epidemiologia Genetica

55 From single studies done in small and large series to meta- analyses Strategies: small series --> better clinical definition Power: > large series, multicentric studies: ratial, ethnical differences

56 OR for CAD and stroke: factor II (G20210A and AA genotypes). OR for CADand stroke for factor V (G1691A and AA genotypes). factor VII (353RQ and QQ genotypes). GP IIIa (PI A1/A2 and A2/A2 genotypes). MTHFR (677TT genotypes). SNIPS and CAD AJC, 2001

57 From genotyping to functional studies Experimental setting to understand the potential links among different risk factors

58 Protein studies Sequencing Domains Modelling Interactions

59 7 transmebrane motif receptor (beta receptors)

60 Chain A Chain B Chain C Ligands TNF R associated factor 2 in complex with a 17-residue cd40 peptide

61 Chain: L ( 36 residues ) - [K&S: 1 helix ] Chain: H ( 150 residues ) - [K&S: 3 helices, 7 strands ] Chain: E ( 109 residues ) - [K&S: 3 helices, 5 strands ] Chain: F ( 11 residues ) Chain: J ( 36 residues ) - [K&S: 1 helix ] Chain: K ( 259 residues ) - [K&S: 5 helices, 13 strands ] Chain: G ( 11 residues ) Chain: M ( 36 residues ) - [K&S: 3 helices ] Chain: N ( 259 residues ) - [K&S: 5 helices, 12 strands ] Chain: I ( 11 residues ) - [K&S: 1 helix ] Thrombin complex with fibrinopeptide alpha (residues ) (three complexes - one with epsilon-thrombin and two with alpha-thrombin)

62 Main-chain trace Chain: A ( 357 residues ) - [K&S: 11 helices, 15 strands ] Chain: P ( 15 residues ) - [K&S: 1 strand ] *Ligands (shown as all atoms) Ligand: SEO Human plasminogen activator inhibitor-2.

63 Genetic + environmental factors or gender Genotypes in smokers Genotypes in females Genotypes in more than one gene + life style Aims: to test the reciprocal effects

64

65 Same gene polymorphisms increase the risk for a series of different disorders

66 RASLDLrHcysBeta2ARTNF ApoEIls Hundreds of SNPS

67 Future Pharmacogenetics Genotype guided treatments Genotype-bsed trials Individual genetic risk

68 MICROARRAY TECHNOLOGY 3Gene expression analysis 3Mutation screening 3Geotyping 3Protein studies 3Antibody study

69 DNA CHIPS The term DNA Chip refers to miniaturised arrays of nucleic acid segments anchored on glass supports no larger than a microscope slide. - cDNA microarrays - Oligonucleotide microarrays P.Gasparini, Corso ANMCO di Epidemiologia Genetica

70 TECHNICAL FOUNDATIONS The field has evolved from Edwin Southern one quarter of century ago: labelled nucleic acid molecules could be used to interrogate nucleic acid molecules attached to a solid support. P.Gasparini, Corso ANMCO di Epidemiologia Genetica

71 MICROCHIP: Affymetrix MICROCHIP: Nanogen P.Gasparini, Corso ANMCO di Epidemiologia Genetica

72 MEDWAY ADVANCE I DEPOSITION OF PRE-SYNTHESIZED OLIGONUCLEOTIDES P.Gasparini, Corso ANMCO di Epidemiologia Genetica

73 C6 aminolink C18 spacer TGCATATAGAGACGAGAAGGGGTGCATATAGAGACGAGAAGGGG TGCATATAGAGACGAGAAGGGGTGCATATAGAGACGAGAAGGGG TGCATATAGAGACGAGAAGGGGTGCATATAGAGACGAGAAGGGG TGCATATAGAGACGAGAAGGGGTGCATATAGAGACGAGAAGGGG CCTT GGAA G/GG/AA/A P.Gasparini, Corso ANMCO di Epidemiologia Genetica

74 cell culture or tissue sample total RNA isolation DNP and Biotin cDNA co-hybridization TSA fluorescence detection imaging and data analysis Expression profiling P.Gasparini, Corso ANMCO di Epidemiologia Genetica

75 MICROARRAY:expression profiling Non affected Affected P.Gasparini, Corso ANMCO di Epidemiologia Genetica

76 Application of Microarrays 1) Gene Expression and Discovery (Which genes are expressed and to what magnitude?) 2) Predicting gene function 3) Linking cell pathways 4) Fingerprint of celluar or disease phenotype 5) Drug discover and drug target validation

77 MICROARRAY: expression profiling Melanoma vs. normal P.Gasparini, Corso ANMCO di Epidemiologia Genetica

78 Per maggiori informazioni Le diapositive del corso extramurale ANMCO di epidemiologia genetica svoltosi a Roma il 13 e 14 ottobre 2001 sono consultabili al sito dellANMCO Area Genetica presso:


Scaricare ppt "La cardiologia preventiva nella pratica clinica Le basi: genetica ANMCO - Corso Intramurale Firenze 22-24 ottobre, 2001 Eloisa Arbustini, IRCCS San Matteo,"

Presentazioni simili


Annunci Google