La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Lezione 17 - 18 mercoledì 27 aprile 2011 corso vettori biologici II Biotec industriali ore 14:00 -16:00 aula 6A.

Presentazioni simili


Presentazione sul tema: "Lezione 17 - 18 mercoledì 27 aprile 2011 corso vettori biologici II Biotec industriali ore 14:00 -16:00 aula 6A."— Transcript della presentazione:

1 Lezione mercoledì 27 aprile 2011 corso vettori biologici II Biotec industriali ore 14:00 -16:00 aula 6A

2 Clonaggio in plasmidi dedicati con prodotti PCR con TAQ polymerase w.t. si hanno aggiunte di A terminali spuri TAQ proof reading o altri producono ampliconi “blunt ends” Secondo che enzima si usa, si sceglie un plasmide adeguato. Esistono in vendita: - plasmidi gia’ linearizzati con coda di T terminale per facilitare la ligasi tra l’amplicone ed il plasmide - plasmidi con topoisomerasi coniugata all’estremita’ del plasmide che attacca direttamente l’amplicone senza bisogno di ligasi Clonaggio dei prodotti PCR

3 cerchiamo delle estremità ad un frammento di PCR intersperso all’interno di una sequenza ignota: - se ho trovato da Southern un frammento di DNA a sequenza ignota (però conosco la sonda), - una inserzione di un frammento noto in un genoma, - un vettore che si è integrato in una regione ignota, - un virus integrato non sito specifico, - una ricerca “gene trapping”, - la ricerca delle estremità genomiche di un gene noto solo come cDNA

4 la soluzione è la PCR inversa Si ha un ancoraggio sulla sequenza nota e nient’altro Si deve amplificare in maniera inversa rispetto ad una PCR normale Quale stratagemma si usa? Circolarizzare un frammento dopo analisi di restrizione per Southern utilizzando la sequenza nota come sonda Il templato può essere un frammento proveniente da una delle possibili analisi precedenti

5 analisi Southern del frgm deve essere scelto il frammento da amplificare sequenza genomica o di Bac o da cui si vuole recuperare la sequenza nota inserita o integrata digestione con enzimi di restrizione verde : no buono bleu : no buono giallo: no buono viola: troppo lungo marrò: buono rosso: buono grigio + viola: buono - tra due buoni si sceglie quello con estremità coesive per la ligasi più efficiente - si evita l’enzima che taglia all’interno del frgm, si otterrebe solo una estremità (diversa strategia) grigio + viola se dx troppo lungo, estremità compatibili

6 dopo l’analisi Southern Dopo l’individuazione del frammento di ampiezza conveniente - digestione del DNA con l’enzima prescelto - arricchimento del frammento con corsa su gel (opzionale) - ligasi - PCR con primers divergenti - eventualmente seconda PCR con primers “nested” ancora più esterni ai primi, ma interni al frgm lineare - una PCR produce sempre frgm lineari !!!!

7 PCR inversa Il nome deriva dal fatto che si usano primers disegnati su una sequenza con direzione divergente, direzione di sequenza dei primers apparentemente non convergente. Analisi Southern Frammento di DNA Ligasi per circolarizzare il frammento A B c d Sequenza nota (primers divergenti) si amplifica il frammento circolare nella regione ignota BA Sequenza nota primers divergenti C D seq ignote

8 amplificazione di DNA genomico o clonato al primo ciclo cosa si amplifica ? la Taq polimerase si ferma sull’amplicone ? termini dell’amplicone primer frw la taq polimerasi non ha ostacoli e non si ferma allora ? perchè si amplifica solo l’amplicone ? primer rev

9 Orientamento primers PCR inversa 5’ 3’ 5’ 3’ c d d c c d 5’3’ 5’ 3’ 5’ a b ba ab ligasi del sito di restrizione

10 PCR nested per PCR inversa estremità ignote digerite su DNA genomico e legate regione nota I primers dovranno sempre essere complementari ai due diversi filamenti I coppia divergente II primer I amplicone II amplicone I primer II primer PCR nested quando si vuole ottenere maggiore specificità

11 Primo ciclo frgm + lungo d d c c d frammento di restriz legato c-d sequenza nota I ciclo II ciclo d c d c d c c possibilità di concatenamero se la taq prosegue

12 si amplifica solo l’amplicone dal II ciclo compare il frammento con le estremità corrispondenti al 5’ dei due primers: primer frw la taq polimerasi non ha ostacoli e non si ferma primer rev primer frw templato I amplificaz

13 il prodotto di PCR è sempre lineare sia nella PCR diretta che inversa con un DNA circolare provate a farvi uno schema!

14 Metodo real time Differenza con PCR standard “end point” “end point” si intende reazione a termine Analisi dell’amplificazione in tempo reale Tramite fluorescenza dei prodotti amplificati Colorante fluorescente del DNA intercalante CYBRgreen Marcatura dei primers o doppia sonda: “FRET”; “TaqMan”; “amplifluor”

15 Principio del funzionamento real-time Analisi dell’amplificazione ad ogni ciclo lettura laser della fluorescenza (qualunque metodo) Soglia di superamento rumore di fondo Inizio crescita log macchina tra cicli Curva sigmoide Effetto inibiz. 10pg 5pg 1pg 0.5pg no DNA determinazione di sensibilità del metodo

16 1 log per 3.3 cicli Crescita a esponente 2 ogni tre,tre cicli 10 x incremento n. cicli f l u o r. Intercetta col “cut off” background = punto inizio log phase determinabile La conc. Misurata con una curva standard di riferimento x = condizioni Ascissa n. cicli / ordinata fluorescenza

17 Ogni genoma ha un certo numero di siti di restrizione per tipo di enzima di restrizione - si digerisce il genoma e ci si legano degli adapters - si disegnano dei primers che contengono l’adapter ed una sequenza random al 3’ con due, tre, quattro, cinque, sei… nucleotidi secondo quanto si vuole essere selettivi; da migliaia di frammenti si passa a meno di cento - Gli oligonucleotidi verso il 3’ oltre l’adapter possono contenere solo certi nucleotidi e allora sono piu’ selettivi e diminuiscono il numero di frammenti specifici rendendo il pattern piu’ semplice da analizzare. AFLP Amplified restriction fragment lenght polymorphisms

18 Dagli RFLPs agli AFLPs Nuovo metodo di studio dei polimorfismi con approccio globale genomico Studio dei polimorfismi di frammenti di restrizione non conosciuti con amplificazione tramite PCR selettiva dei frammenti genomici Approccio globale con micro-cips

19 Polimorfismo dei frammenti di restrizione amplificati (AFLP)

20 Produzione in multiplex di marcatori con un singolo esperimento. Produzione contemporanea di bande polimorfiche tra individui (DNA fingerprinting) e di monomorfiche entro e polimorfiche tra specie (identificazione di specie) Applicabili al genoma di qualsiasi specie senza bisogno di informazioni a priori sulle sequenze o di disponibilità di sonde Schema dei primers usati

21 Fasi dell’esperimento ! digestione con Eco RI del genoma in analisi !! digestione della I reazione con Taq I (o altro enzima) !!! ligasi con la miscela dei due adattatori !!!! preamplificazione senza marcatura !!!!! amplificazione con primers marcati !!!!!! corsa su gel di acrilamide 4,5% !!!!!!! rivelazione con autoradiografia o elettroforesi capillare in alternativa corsa elettroforetica capillare con fluorescenza

22 Adattatori e Primers Adattatori secondo il metodo pubblicato da Pieter Vos et al. Nucl.Acid Res. 1995, 23 n.21, e Paolo Ajmone- Marsan et al. Animal Genetics 1997, 28, adattatore Eco RI 5’ 3’ 5’ 3’ CTGGTAGACTGCGTACC AATTCnnnnnnnnG AATTGGTACGCAGTCTAC CATCTGACGCATGGTTAA GnnnnnnnnCTTAA CCATGCGTCAGATGGTC 3’ 5’ 3’ 5’ adattatore Eco RI frammento di restrizione adattatore Taq I GACGATGAGTCCTGAC CGAnnnnnnnnnnnnnT CGGTCAGGACTCAT TACTCAGGACTGGC TnnnnnnnnnnnnnAGC CAGTCCTGAGTAGCAG adattatore Taq I e terza combinazione con adattatori Eco e Taq sui frammenti tagliati regolarmente

23 Elettroforesi su acrilamide Ogni lane è un soggetto Il n. di bande presenti costituisce il pattern allelico Alcuni alleli sono molto frequenti (strisce orizzontali) possono caratterizzare la razza animale

24 AFLPs gel acrilamide PCR-based screening of BAC DNA pools for SAS-DNA markers using AFLP technology. AFLP templates were prepared from BAC DNA PPs (1-32) and SPs (1-16) and selectively amplified with fluorescent-labeled EcoRI + TGA and MseI + CGG. Labeled products were analyzed on a LI-COR DNA sequencer. AFLP template from genomic DNAs (IS3620C and BTx623) were run as controls and are indicated above the respective lanes. Arrows to the right of the gel show selected SAS DNA markers that were analyzed in the DNA pools. Asterisks to the right of a subset of the markers indicate those SAS DNAs that revealed polymorphisms between BTx623 and IS3620C and could be mapped as AFLPs on the sorghum genetic map. Fluorescent-labeled molecular weight markers (LI-COR) were run in lanes marked M and their sizes (bp) are shown to the left of the gel.

25 Elettroforesi capillare

26 cosa è una“Nested” PCR Per aumentare la specificità con PCR ottimizzata e non ulteriormente ottimizzabile con i parametri di reazione Se si deve avere un prodotto di amplificazione con alta efficienza eliminando altri prodotti indesiderati -a) omologia parziale dei primers già ottimizzati -b) sequenze omologhe, pseudogeni, sequenze duplicate caso a: trovare una seconda coppia di primers interni al primo amplicone (probabilità limitata di omologia di entrambe le sequenze in una stessa regione) caso b: cercare le regioni divergenti dove scegliere altre coppie di primers primer frw. I primer rev.I primer frw. II primer rev.II II amplicone interno

27 PCR nested primo esempio Quando abbiamo un amplicone per esempio di 500 bp 5’ 3’5’ 3’ pr frw pr rev 5’ 3’ 1° amplicone 5’ 3’ II pr frw II pr rev 2° amplicone nested il secondo amplicone sarà più breve secondo la posiz. dei primers

28 esercizio 1 CTCAGAGCTG GGAAGGAGGC TCTAGATGGC GGCTGTGCCT TAGAGAGAGC GCGCTCTGCT 61 CCCTGCCTTT GCCTCACTTT ACGCAACTTT CCCTAACTTT CGGGCAGCCT CAGGGGGCCC 121 CCGTAGCCCC CTGCCTTTCC TAGGGACTTA CTGGGGTCGA TTCGAACCTT TTTTTGGGAG 181 AAAAGCAGCT TTTAGGAGCT TTCTTTTCGT GCCTTGTTGG AAAGAAGCAG CCGTACTGAG 241 AGCCCAGGTC GTTGTTTTTT CCAGCTTAGA AGCCATGGCG CACCTCCATT TTTGTGCGCT 301 CTCCTAATGA GGTTTTTTTT CTTTCGGACC TGTTTTAGTA TTAATTATTG CTTTATTTTT 361 TTGACCAGTT AACATATTTG AGGGTTATTT TATTTATTTT TCGTTTTTTA ACGGAGGATT 421 TTGCCTTTAT TTTTAATTAT TTGGGATCTG ATATTTTTCT ACTAGTAGAT AGGACTCTTG 481 GTTTGGACAT ACTACATGGA TCAGTAAATA CCTGGGCACA GGACTTCAAA GCAAACACAG 541 ATTCCCCCTC CCCCTTAATA TTTAAGAATT AAAAGATGAT GAGAAATAAG GACAAAAGCC 601 AAGAGGAGGA CAGTTCGCTA CACAGCAATG CATCGAGTCA CTCAGCCTCT GAAGAAGCTT 661 CGGGTTCAGA CTCAGGCAGT CAGTCGGAAA GTGAGCAGGG AAGTGATCCA GGAAGTGGAC 721 ATGGCAGCGA GTCGAACAGC AGCTCTGAAT CTTCTGAGAG TCAGTCGGAA TCTGAGAGCG 781 AATCAGCAGG TTCCAAATCC CAGCCAGTCC TCCCAGAAGC CAAAGAGAAG CCAGCCTCTA 841 AGAAGGAACG GATAGCTGAT GTGAAGAAGA TGTGGGAAGA ATATCCTGAT GTTTATGGGG 901 TCAGGCGGTC AAACCGAAGC AGACAAGAAC CATCGCGATT TAATATTAAG GAAGAGGCAA 961 GTAGCGGGTC TGAGAGTGGG AGCCCAAAAA GAAGAGGCCA GAGGCAGCTG AAAAAACAAG 1021 AAAAATGGAA ACAGGAACCC TCAGAAGATG AACAGGAACA AGGCACCAGT GCAGAGAGTG - Trova i primers per fare una PCR di un frammento di circa bp di questa sequenza, - trova i primers per una PCR nested. - Trova i primers per una PCR inversa e nested - Trova a che gene appartiene questa sequenza

29 esecuzione esercizio 1°primer forward: da b.72 a 92 = 21 basi; 10 GC, 11 AT = =T melting 62°C 1°primer reverse: da 786 a 767 = 20 basi; 10 GC, 10 AT = = T melting 60°C amplicone = 715 bp (da 72 a 786) nested: 2° forward: da b. 121 a 140 = 20 basi; 14 GC, 6 AT = = T melting 68°C 2° reverse: da b. 520 a 498 = 23 basi; 11 GC, 12 AT = = T melting 68°C amplicone = 400 bp (da 121 a 520) Il gene ? andare su nucleotide dalla banca dati:

30 esercizio II parte PCR inversa: dopo aver analizzato per Southern la regione si sceglie l’enzima di restrizione per avere un frammento di circa 4-6 kb scelta dei primers: 2° e 1° primer forward invertiti (rev. compl.) del 1° amplicone 1° primer rev inv. e 2° da b. 961 a 982 cerca la sequenza in banca dati su sito NCBI: nucleotide blast: UniGene infoGeoGene info Homo sapiens chromodomain helicase DNA binding protein 2 (CHD2), transcript variant 1, mRNA; Length=9374

31 segnare i primers 1 CTCAGAGCTG GGAAGGAGGC TCTAGATGGC GGCTGTGCCT TAGAGAGAGC GCGCTCTGCT 61 CCCTGCCTTT GCCTCACTTT ACGCAACTTT CCCTAACTTT CGGGCAGCCT CAGGGGGCCC 121 CCGTAGCCCC CTGCCTTTCC TAGGGACTTA CTGGGGTCGA TTCGAACCTT TTTTTGGGAG 181 AAAAGCAGCT TTTAGGAGCT TTCTTTTCGT GCCTTGTTGG AAAGAAGCAG CCGTACTGAG 241 AGCCCAGGTC GTTGTTTTTT CCAGCTTAGA AGCCATGGCG CACCTCCATT TTTGTGCGCT 301 CTCCTAATGA GGTTTTTTTT CTTTCGGACC TGTTTTAGTA TTAATTATTG CTTTATTTTT 361 TTGACCAGTT AACATATTTG AGGGTTATTT TATTTATTTT TCGTTTTTTA ACGGAGGATT 421 TTGCCTTTAT TTTTAATTAT TTGGGATCTG ATATTTTTCT ACTAGTAGAT AGGACTCTTG 481 GTTTGGACAT ACTACATGGA TCAGTAAATA CCTGGGCACA GGACTTCAAA GCAAACACAG 541 ATTCCCCCTC CCCCTTAATA TTTAAGAATT AAAAGATGAT GAGAAATAAG GACAAAAGCC 601 AAGAGGAGGA CAGTTCGCTA CACAGCAATG CATCGAGTCA CTCAGCCTCT GAAGAAGCTT 661 CGGGTTCAGA CTCAGGCAGT CAGTCGGAAA GTGAGCAGGG AAGTGATCCA GGAAGTGGAC 721 ATGGCAGCGA GTCGAACAGC AGCTCTGAAT CTTCTGAGAG TCAGTCGGAA TCTGAGAGCG 781 AATCAGCAGG TTCCAAATCC CAGCCAGTCC TCCCAGAAGC CAAAGAGAAG CCAGCCTCTA 841 AGAAGGAACG GATAGCTGAT GTGAAGAAGA TGTGGGAAGA ATATCCTGAT GTTTATGGGG 901 TCAGGCGGTC AAACCGAAGC AGACAAGAAC CATCGCGATT TAATATTAAG GAAGAGGCAA 961 GTAGCGGGTC TGAGAGTGGG AGCCCAAAAA GAAGAGGCCA GAGGCAGCTG AAAAAACAAG 1021 AAAAATGGAA ACAGGAACCC TCAGAAGATG AACAGGAACA AGGCACCAGT GCAGAGAGTG 1° frw; 2 inv 2° frw; 1 inv 2° rev 1° rev; 1° inv 2° inv inv = primer per PCR inversa che ha due coppie di primers per poter fare una PCR nested, quelli al 5’ della seq. devono essere complementary-reverse e quelli al 3’ sono uguali alla sequenza stampo data

32 primers con code! la regione di annealing deve essere efficiente sul 3’ templato 3’ 5’ 3’ la coda verrà inserita e dal ciclo successivo fara parte dell’amplicone amplicone con coda incorporata 5’ 3’

33 se i primers hanno la coda 5’3’ 5’ 3’ 5’ 3’ alla polimerase importa solo che il 3’ sia appaiato, però la coda del primer sarà incorporato e farà parte dell’amplicone è la stessa cosa che succede in una amplificazione aspecifica in cui solo il 3’ del primer (specifico) trova omologia di sequenza e farà amplificare un prodotto non specifico

34 Per fare avvenire una delezione o inserzione si utilizza il metodo a tre passaggi (esempio per inserzione). per inserire la sequenza mutata nella sequenza voluta o si seleziona un ricombinante dopo trasfezione o si inserisce direttamente la sequenza mutagenizzata con enzimi di restrizione. Mutagenesi tramite uso di primers modificati pr.ext. frw. pr.int. rev. pr.ext. rev. pr.int. frw. 3’ 5’ a b pr.ext. frw. pr. int. rev. 3PCR indipendenti pr.ext. frw. pr.ext. rev. I III ( ) ( ) pr.int. frw. pr.ext. rev. inserzione II I e II PCR indipendenti b a ab

35 Mutagenesi con PCR in tre passaggi DNA mitocondriale bovino acc. N. V00654, gi con bp L8014 (external forward primer) 5 ’ -ACCCATTGTCCTTGAGTTAGT-3 ’, H8393 (external reverse primer) 5 ’ -GAGGGTTACAAAGCGATTGCT-3 ’, H8242 (internal reverse primer) 5 ’ -GAGATCTGCCGTACAGGCCTAGAATATTTTTGTTGGTGTCAGT-3 ’ and L8283 (internal forward primer) 5 ’ -CTAGGCCTGTACGGCAGATCTCAAAACAAAACACCCCTTGAGA-3 ’, III PCR per estensione della regione sovrapposta I primers interni L8283 e H8242 hanno una coda al 3 ’ -terminale che è stata usata per introdurre una inserzione di 22 bp (parte sottolineata nella sequenza del primer). La complementariet à sta nell ’ inserzione tra il 3 ’ dell ’ int. frw. primer ed il 5 ’ dell ’ int.rev.primer L ’ inserzione permette di discriminare per peso molecolare la sequenza bovina da quella del nuovo costrutto usato nella PCR competitiva come riferimento con varie diluizioni a partire da una concentrazione nota. Il competitore sintetico è stato clonato nel vettore pBlueScript KS + della ditta Stratagene (La Jolla, Ca.CA USA).

36 Complementarietà delle code H8242 (internal reverse primer) 5 ’ -GAGATCTGCCGTACAGGCCTAGAATATTTTTGTTGGTGTCAGT-3 ’ and L8283 (internal forward primer) 5 ’ -CTAGGCCTGTACGGCAGATCTCAAAACAAAACACCCCTTGAGA-3 ’ 3 ’………… TTTTATAAGATCCGGACATGCCGTCTAGAG seq mitoc. spec coda per appaiamento 5’ 3’ int rev pr templato int frw pr 5’ 3’ 5’ 3’ 5’ templato

37 appaiamento PCR I + II 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ X X 5’ “elongation” solo di due filamenti impossible mission impossible possible

38 di un frammento f in un amplicone (3 steps = 3 passaggi) inserzione frw rev a f f b inserzione frw rev a f b f f annealing di 2 PCR a b PCR I = a PCR II=b x y 5’ 3’ elongation primer frw e rev interni sono contigui per poter inserire la sequenza f

39 di un frammento b da un amplicone frw rev a b c delezione a b a c 1 2 c 3’liberooredil 3’ c a annealing II PCR delezione primer 1 e 2 interni iniziano e finiscono sui limiti della sequenza da deletere

40 in un amplicone in 3 passaggi z 3’ aI c b z z 5’ II III annealing III PCR ed “extension” II PCR separate z a c 3’ 5’ ac z 3’ 5’ 3’ 5’ PCR finale sostituzione 5’

41 giunzione di due frammenti distanti la procedura è la stessa di quella della delezione, la differenza consiste nella collocazione del secondo amplicone che si vuole legare al primo che può essere ovunque nel genoma, unica condizione necessaria è la presenza delle code complementari dei primers che è obbligatoria, basta scegliere quale sequenza va al 5’ e quale al 3’ del nuovo amplicone artificiale x y

42 x y quali code sono produttive ? 3’ 5’ cc aa cc 5’ 3’ cc x tt gg aa gg tt y 5’ aa cc 3’ 5’ gg 3’ tt 5’ x 3’ 5’ cc aa 5’ 3’ gg tt ordine del prodotto : x - y cc y 5’ A) code compl. rev strand +/- aa B) code rev.perchè non funge? 3’

43 cc 5’ 3’ gg altre code 5’ 3’ aa 5’ 3’ gg tt x y si tt aa cc no 5’ 3’ 5’ 3’ gg tt y aa cc 5’ 3’ x verso = x - y strand +/+ dirette aa cc 5’ 3’ tt gg no si verso = y - x strand +/- invertite code = al 3’ e 5’ code invertite al 5’

44 Questo terzo metodo che abbiamo visto, può essere utilizzato sia per ottenere inserzioni o sostituzioni, ma anche delezioni però con l’inserzione di un nuovo frammento di lunghezza diversa, anche molto diversa per avere una regione di omologia per l’appaiamento ed “elongation”. Dipende da dove si fanno partire i primers interni con la coda. In realtà si possono giuntare anche frammenti non limitrofi per costruire geni di fusione. Si possono legare esoni di geni diversi come per esempio esoni di un gene a cui attaccare la GFP o Lac Z. Applicazioni dell’ultimo metodo

45 riepilogo RT-PCR nested PCR mutagenesi


Scaricare ppt "Lezione 17 - 18 mercoledì 27 aprile 2011 corso vettori biologici II Biotec industriali ore 14:00 -16:00 aula 6A."

Presentazioni simili


Annunci Google