La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

DNA Replication. DNA Replication II Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del.

Presentazioni simili


Presentazione sul tema: "DNA Replication. DNA Replication II Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del."— Transcript della presentazione:

1 DNA Replication

2 DNA Replication II

3 Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del DNA La replicazione è semiconservativa: ogni frammento di DNA serve da stampo per la sintesi di una nuova molecola di DNA

4 Esperimento di Meselson e Stahl - centrifugazione in gradiente di densità allequilibrio per distinguere DNA contenenete 14 N pesante e DNA 15 N più leggero

5

6

7

8 DEFINIZIONI e TERMINOLOGIA: Replicone= unità di replicazione con propria origine di replicazione. Origine di replicazione=zona specifica del cromosoma dove le doppia elica si denatura in singoli filamenti, esponendo le basi per la sintesi di nuove eliche. Bolla di replicazione:regione del cromosoma dove il DNA è a singole elica e dal quale la replicazione procede in modo bidirezionale.

9 Le modalità di replicazione 1. La replicazione teta Comune in E.Coli e in altri organismi con DNA circolare

10 2. La replicazione a circolo rotante Comune in alcuni virus e nel fattore F di E.coli

11 3. La replicazione lineare negli eucarioti Requisiti per la replicazione: -stampo di DNA a singolo filamento -substrati da assemblare nel filamento di neoformazione -enzimi e altre proteine che leggono lo stampo e assemblano i substrati

12

13

14 La direzione della replicazione

15 La sintesi del DNA è continua su un filamento di DNA stampo e discontinua sullaltro

16

17 Modello teta Modello circolo rotante Replicazione lineare

18 La replicazione del DNA batterico - LINIZIO In E.coli la replicazione ha inizio quando le proteine iniziatrici si legano a oriC, lorigine di replicazione, provocando lo svolgimento di un breve tratto di DNA.

19 - LO SVOLGIMENTO La DNA elicasi svolge il DNA legandosi al filamento ritardato che funge da stampo a livello di ogni forcella di replicazione e muovendosi in direzione 5 3 lungo il filamento.

20 -GLI INNESCHI e LALLUNGAMENTO La primasi sintetizza brevi tratti nucleotidici di RNA, fornendo un gruppo 3-OH a cui la DNA polimerasi può aggiungere nucleotidi di DNA.

21

22

23 DNA Polymerase III The "real" polymerase in E. coli At least 10 different subunits "Core" enzyme has three subunits -,, and Alpha subunit is polymerase Epsilon subunit is 3'-exonuclease Theta function is unknown The beta subunit dimer forms a ring around DNA Enormous processivity - 5 million bases!

24 DNA Polymerase I Replication occurs 5' to 3' Nucleotides are added at the 3'-end of the strand Pol I catalyzes about 20 cycles of polymerization before the new strand dissociates from template 20 cycles constitutes moderate "processivity" Pol I from E. coli is 928 aa (109 kD) monomer In addition to 5'-3' polymerase, it also has 3'-5' exonuclease and 5'-3' exonuclease activities

25 - La DNA LIGASI La DNA ligasi chiude linterruzione lasciata dalla DNA polimerasi I nello scheletro di zucchero-fosfato dopo che questultima ha aggiunto il nucleotide finale.

26 - LA FORCELLA DI REPLICAZIONE Modello di replicazione del DNA in E.coli: le due unità della DNA pol III sono connesse e il filamento ritardato che funge da stampo forma un anello tale che la replicazione possa avere luogo sui due filamenti di DNA antiparalleli.

27 -LA FEDELTA DELLA REPLICAZIONE DEL DNA -selezione dei nucleotidi -correzione di bozze -riparazione dei malappaiamenti

28 Other Proteins That Assist DNA Replication Helicase, topoisomerase, single-strand binding protein Table 16.1

29

30 La replicazione del DNA negli eucarioti Microfotografia elettronica di DNA eucariotico durante il processo della replicazione: il DNA neosintetizzato è già coperto da nucleosomi

31 Polimerasi nei Procarioti I Procarioti possiedono cinque tipi di DNA Polimerasi: Procarioti DNA Polimerasi I: implicata nella riparazione del DNA e nella rimozione degli inneschi dei frammenti di Okazaki. Possiede attività esonucleasica sia in direzione 5'->3', sia in direzione 3'->5'DNA Polimerasi Iriparazione del DNAframmenti di Okazaki DNA Polimerasi II: indotta da danni al DNA per riparazione incline all'errore (error-prone). Ha attività polimerasica 5'->3' ed esonucleasica 3'->5'DNA Polimerasi II DNA Polimerasi III: l'enzima principale per la replicazione, con attività polimerasica 5'->3' ed esonucleasica (nella correzione di bozze, o proofreading) 3'->5'. Attiva sia nella sintesi del filamento leading, sia in quella dei frammenti di Okazaki.DNA Polimerasi IIIfilamento leadingframmenti di Okazaki DNA Polimerasi IV-V: anch'esse coinvolte nella riparazione incline all'errore

32 Polimerasi negli Eucarioti Le Polimerasi degli Eucarioti sono costituite invece da:Eucarioti DNA Polimerasi α: è una primasi (enzima che sintetizza i primer di RNA) e procede inoltre all'allungamento dei primer con alcune centinaia di deossiribonucleotidi.enzimaprimerRNA DNA Polimerasi δ: l'enzima principale della replicazione eucariotica. Sintetizza sia il filamento leading, sia il filamento lagging. Riempie inoltre le interruzioni tra i frammenti di Okazaki.filamento leadingfilamento laggingframmenti di Okazaki DNA Polimerasi β: coinvolta nella riparazione del DNA DNA Polimerasi γ: replica il DNA mitocondrialeDNA mitocondriale DNA Polimerasi ε: stessa funzione della Polimerasi δ.

33

34

35 ProkaryotesEukaryotes 5 polymerases (I, II, III, IV,V) 5 polymerases-- I--excision repair, removal of RNA primers --polymerization II-repair repair --mitochondrial III-main enzyme main enzyme IV,V-repair, special conditions --unknown polymerases also exonucleasesnot all exonucleases 1 Origin of replicationmany origins Okazaki fragments nuc. Okazaki fragments nuc. no proteins on DNAhistones

36

37

38 Tipo di organismoNome scientificoRipetizione telomerica (direzione 5' -> 3') Vertebrati Homo sapiensHomo sapiens, Mus musculus, Xenopus laevisMus musculusXenopus laevis TTAGGG Funghi Neurospora crassaNeurospora crassa, Physarum, DidymiumPhysarum Didymium TTAGGG ProtistiDictyostelium discoideumAG(1-8) KinetoplasteaKinetoplastea (protozoi)TrypanosomaTrypanosoma, CrithidiaCrithidiaTTAGGG protozoiprotozoi ciliaticiliati TetrahymenaTetrahymena, GlaucomaGlaucomaTTGGGG ParameciumTTGGG(T/G) OxytrichaOxytricha, Stylonychia, EuplotesStylonychiaEuplotesTTTTGGGG ApicomplexaPlasmodiumTTAGGG(T/C) PiantePiante superioriArabidopsis thalianaTTTAGGG Alghe verdiChlamydomonasTTTTAGGG InsettiBombyx moriTTAGG AnellidiAscaris lumbricoidesTTAGGC LievitiLieviti a scissione binariaSchizosaccharomyces pombeTTAC(A)(C)G(1-8) LievitiLieviti gemmanti Saccharomyces cerevisiae TGTGGGTGTGGTG (da stampo RNA) o G(2-3)(TG)(1-6)T (sequenza consenso) Candida glabrataGGGGTCTGGGTGCTG Candida albicansGGTGTACGGATGTCTAACTTCTT Candida tropicalis GGTGTA[C/A]GGATGTCACGATCA TT Candida maltosaGGTGTACGGATGCAGACTCGCTT Candida guillermondiiGGTGTAC Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATG T Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATG T

39

40

41

42 Modello di Holliday:rottura singolo filamento

43 Rottura doppio filamento

44

45

46

47

48

49

50


Scaricare ppt "DNA Replication. DNA Replication II Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del."

Presentazioni simili


Annunci Google