La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Identificazione e tipizzazione di minisatelliti Come per gli STRs, lidentificazione dei minisatelliti avveniva in passato mediante ibridazione di sonde.

Presentazioni simili


Presentazione sul tema: "Identificazione e tipizzazione di minisatelliti Come per gli STRs, lidentificazione dei minisatelliti avveniva in passato mediante ibridazione di sonde."— Transcript della presentazione:

1 Identificazione e tipizzazione di minisatelliti Come per gli STRs, lidentificazione dei minisatelliti avveniva in passato mediante ibridazione di sonde ripetitive su library di DNA e successivo subclonaggio e sequenziamento dei cloni positivi. Oggi i minisatelliti vengono identificati in silico nei database di sequenze genomiche con il software tandem repeats finder, esattamente come i microsatelliti. Data la lunghezza dei minisatelliti, non sempre è possibile amplificarli mediante PCR, ed in alcuni casi si utilizza il southern blotting. In questo caso si utilizza spesso una sonda che riconosce un motivo core comune a più minisatelliti, e che permette di evidenziare più minisatelliti contemporaneamente (ma senza conoscere la loro identità)

2 Identificazione e tipizzazione di polimorfismi Alu Identificazione: ricerca in database di elementi Alu giovani (famiglia Alu Y), che hanno una più elevata probabilità di essere stati trasposti durante levoluzione umana e quindi di essere polimorfici. Tipizzazione: tramite PCR, con primers che fiancheggiano il sito di inserzione ed elettroforesi su gel dagarosio. Sono i polimorfismi più facili da analizzare

3 Identificazione e tipizzazione di polimorfismi LINE1 Identificazione: ricerca in database di elementi LINE1 giovani (famiglia Ta), che hanno una più elevata probabilità di essere stati trasposti durante levoluzione umana e quindi di essere polimorfici. Tipizzazione: tramite PCR (vedi figura).

4 SNPs: single nucleotide polymorphisms SNS: single nucleotide substitutions UEPs: unique event polymorphisms STRs: short tandem repeats (microsatelliti) VNTRs:variable number of tandem repeats RFLP: restrict fragment length polymorphism LINEs: long interspersed elements SINEs: short interspersed elements DHPLC: denaturing high performance liquid chromatography SSCP: single strand conformational polymorphism ASA: allele specific amplification ASO: allele specific oligonucleotide

5 LA VARIABILITA GENETICA COME STRUMENTO A.APPLICAZIONI BASATE SUL LINKAGE MAPPATURA GENICA MEDIANTE ANALISI DEL LINKAGE NELLE FAMIGLIE MAPPATURA GENICA MEDIANTE ANALISI DEL LINKAGE A LIVELLO DI POPOLAZIONI (LINKAGE DISEQUILIBRIUM MAPPING) DIAGNOSI PRENATALE B.GENETICA FORENSE IDENTIFICAZIONE PERSONALE PATERNITA INCERTA C.STUDI SULLEVOLUZIONE INTERSPECIE INTERPOPOLAZIONI DNA antico

6 In qualsiasi tipo di applicazione dovrete scegliere tra diversi tipi di marcatori. Per fare questo bisogna tener conto di una serie di caratteristiche dei diversi marcatori, che possono essere più o meno importanti a seconda dei casi: distribuzione sul genoma tasso di mutazione grado di eterozigosità tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo Caratteristiche biologiche Caratteristiche tecniche

7 distribuzione sul genoma tasso di mutazione grado di eterozigosità tempi tecnici dellesperimento costi dellesperimento possibilità di tipizzare con PCR costi dellattrezzatura precisione del metodo Escludiamo, per tutte le applicazioni, polimorfismi di repeats telomeriche, macrosatelliti, varianti strutturali Escludiamo, per tutte le applicazioni, variazioni di numero e grandi variazioni di struttura dei cromosomi Consideriamo quindi: SNPs (include SNS e insdel di una base); piccole insdel > 1bp; microsatelliti, minisatelliti, polimorfismi Alu e LINE1

8 distribuzione nel genoma: fondamentale, omogeneamente distribuiti e comuni nel genoma: OK STRs e SNPs tasso di mutazione: poco rilevante grado di eterozigosità: fondamentale, il numero di meiosi informative è correlato al grado di eterozigosità del marcatore: OK STRs e parte degli SNPs (quelli con H elevata) tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo possibilità di automazione su larga scala: OK SNPs

9 distribuzione nel genoma: fondamentale, omogeneamente distribuiti e comuni nel genoma: OK STRs e SNPs tasso di mutazione: molto importante, OK SNPs grado di eterozigosità: importante OK STRs e parte degli SNPs (quelli con H elevata) tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo possibilità di automazione su larga scala: OK SNPs

10 distribuzione nel genoma: sufficiente che i geni non siano in LD per una più facile trattazione statistica: OK tutti i marcatori tasso di mutazione: non rilevante OK tutti i marcatori grado di eterozigosità: fondamentale, maggiore leterozigosità, maggiore linformazione. OK minisatelliti, STRs ereditarietà mendeliana: importante per una più facile trattazione statistica tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo tipizzazione mediante PCR: fondamentale: spesso quantità di DNA minime possibilità di automazione su larga scala: non rilevante

11 distribuzione nel genoma: sufficiente che i geni non siano in LD per una più facile trattazione statistica: OK tutti i marcatori tasso di mutazione: non fondamentale ma da tenere in considerazione OK tutti i marcatori grado di eterozigosità: fondamentale, maggiore leterozigosità, maggiore linformazione: OK minisatelliti, STR ereditarietà mendeliana: importante per una più facile trattazione statistica OK STR, SNPs tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo tipizzazione mediante PCR: non rilevante se non in relazione ai costi possibilità di automazione su larga scala: non rilevante

12 distribuzione nel genoma: non rilevante tasso di mutazione: fondamentale, deve essere contenuto OK SNPs, NO STRs grado di eterozigosità: non rilevante tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo tipizzazione mediante PCR: non rilevante se non in relazione ai costi

13 distribuzione nel genoma: non rilevante tasso di mutazione: dipende dal contesto, possono essere usati SNPs, Alu, STRs, ma in modo diverso grado di eterozigosità: +/- importante a seconda dei casi tempi tecnici dellesperimento costi dellattrezzatura costi dellesperimento precisione del metodo: fondamentale

14 Un allele è una variazione ad un locus La frequenza allelica è la frequenza di un certo allele in una popolazione. Es. Popolazione composta da 20 omozigoti CC 45 eterozigoti CT 35 omozigoti TT Frequenza allele C = (20 x )/ 2x100 = Frequenza allele T = (35 x )/ 2x100 = ad esempio Allele 1: CCGCTACGTACGGCGATCGATGGCGGCCACGCTCGCGATCGCTACGCTA Allele 2: CCGCTACGTACGGCGATCGATGGCGGCTACGCTCGCGATCGCTACGCTA Eterozigosità della popolazione per il locus in esame = = 0.489

15 Equilibrio di Hardy-Weinberg Assunzioni: accoppiamento casuale no mutazione no migrazione no selezione popolazione infinita (no deriva genetica) = p 2 = q 2 = 2pq AA Aa aa sia p la frequenza di A, e q la frequenza di a. Le frequenze genotipiche raggiungono lequilibrio in una generazione; Le frequenze alleliche rimangono costanti nel tempo Allequilibrio:

16 La variabilità interpopolazioni Le frecce indicano il tipo di variabilità più frequentemente osservata nelle popolazioni umane Esiste variabilità tra popolazioni, relativamente ad un locus, quando le frequenze degli alleli sono diverse tra le popolazioni La variabilità interpopolazioni si misura mediante distanze genetiche, La misura di distanza genetica più utilizzata è lindice di fissazione F ST Note per gli studenti: per la variabilità intrapopolazioni fai riferimento alle diapositive 24-25

17 Lindice di fissazione F ST Date 2 popolazioni pop1 e pop2 con frequenze alleliche ad un sito polimorfico pari a p 1 e q 1 (pop1) p 2 e q 2 (pop2) con p 1 + q 1 =1 e p 2 + q 2 = 1 (ovvero un sito biallelico) Definiamo metapopolazione una popolazione con frequenze alleliche pm e qm che sono la media delle frequenze delle due popolazioni: P m = (p 1 + p 2 )/2 q m = (q 1 + q 2 )/2 F ST = (H T – H S )/H T Dove H T è pari a alla eterozigosità attesa della metapopolazione e H S è la media delle eterozigosità attese delle due popolazioni po1 e pop2 HT = Eterozigosità attesa della metapopolazione secondo HW = 2p m q m HS = media delle eteroz. attese nelle due popolazioni secondo HW = (2p 1 q 1 +2p 2 q 2 )/2

18 Date 2 popolazioni pop1 e pop2 Con frequenze alleliche ad un sito polimorfico pari a p1 e q1 (pop1) p2 e q2 (pop2) con p1+ q1=1 e p2+ q2 = 1 (ovvero un sito biallelico) F ST = (varianza di p) / p q varianza di p = [(p 1 -p) 2 + (p 2 -p) 2 ] / 2 p = p medio = (p 1 + p 2 ) / 2 Lindice di fissazione FST (DEFINIZIONE ALTERNATIVA MA EQUIVALENTE)

19 pop1 p 1 = 0.6; q 1 = 0.4 pop2p 2 = 0.3;q 2 = 0.7 pop1 p 1 = 0.9; q 1 = 0.1 pop2p 2 = 0.1;q 2 = 0.9 pop1 p 1 = 1.0; q 1 = 0.0 pop2p 2 = 0.0;q 2 = 1.0 F ST = (varianza di p) / ( p q ) F ST = [( ) 2 + ( ) 2 ] / 2 / (0.45 x 0.55) = F ST = [( ) 2 + ( ) 2 ] / 2 / (0.5 x 0.5) = F ST = [( ) 2 + ( ) 2 ] / 2 / (0.5 x 0.5) = pop1 p 1 = 0.3; q 1 = 0.7 pop2p 2 = 0.3;q 2 = 0.7 F ST = [( ) 2 + ( ) 2 ] / 2 / (0.3 x 0.7) = Alcuni esempi per il calcolo di F ST

20


Scaricare ppt "Identificazione e tipizzazione di minisatelliti Come per gli STRs, lidentificazione dei minisatelliti avveniva in passato mediante ibridazione di sonde."

Presentazioni simili


Annunci Google