La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

UN PO DI STORIA... 1900 - Riscoperta delle leggi della trasmissione ereditaria dei caratteri, che Mendel aveva pubblicato nel 1865 e che avevano come.

Presentazioni simili


Presentazione sul tema: "UN PO DI STORIA... 1900 - Riscoperta delle leggi della trasmissione ereditaria dei caratteri, che Mendel aveva pubblicato nel 1865 e che avevano come."— Transcript della presentazione:

1

2 UN PO DI STORIA Riscoperta delle leggi della trasmissione ereditaria dei caratteri, che Mendel aveva pubblicato nel 1865 e che avevano come assunto l'esistenza di fattori discreti, elementen, i geni, che determinano i caratteri e che si trasmettono da una generazione all'altra Sutton ipotizza che i fattori mendeliani, i geni, siano localizzati sui cromosomi Morgan inizia a mappare i geni sui cromosomi del moscerino della frutta D.Melanogaster Avery MacLeod e McCarty stabiliscono che il DNA è il materiale ereditario Watson e Crick propongono la struttura a doppia elica per il DNA Viene stabilito che il patrimonio cromosomico completo dell'uomo è di 46 cromosomi Viene decifrato il codice genetico, ovvero stabilito il rapporto tra le 64 triplette possibili a partire dalle 4 basi nucleotidiche del DNA, e i 20 aminoacidi che formano le proteine.

3 Mary Weiss e Green introducono la tecnica dell'ibridazione delle cellule somatiche che rende più agevole la mappatura dei geni umani Berg costruisce la prima molecola DNA ricombinante in vitro utilizzando gli enzimi di restrizione. Vengono realizzati con successo i primi esperimenti di clonazione del DNA Cohen, Chang e Boyer costruiscono il primo batterio ricombinante. Si tiene la prima conferenza sulla mappatura dei geni umani Cohen e Boyer ottengono l'espressione di un gene estraneo trapiantato in un batterio con la tecnica del DNA ricombinante Si tiene la conferenza di Asilomar che propone una moratoria sugli esperimenti con il DNA ricombinante in assenza di linee guida per la sicurezza delle manipolazioni genetiche Per la prima volta un gene umano viene ricombinato e inserito in un batterio per clonare una proteina, la somatostatina Sanger, già premio Nobel come inventore del metodo per sequenziare le proteine, sviluppa un metodo nuovo ed efficiente per sequenziare il DNA (contemporaneamente Gilbert e Maxam inventano un metodo analogo).

4 Boyer costruisce una versione sintetica del gene dell'insulina e lo inserisce in un batterio. La Genentech, fondata nel 1976 dallo stesso Boyer insieme a Swanson, otterrà il permesso di commercializzare l'insulina prodotta per ingegneria genetica nel 1982 e quindi il brevetto Vengono sviluppate nuove tecniche basate sull'ibridazione molecolare e l'utilizzazione come marcatori delle variazioni individuali del DNA per mappare fisicamente i geni e le sequenze geniche sui cromosomi. Grazie alle nuove tecniche e alla collaborazione internazionale tra i mappatori, i geni mappati passano da 579 nel 1981 a nel 1991: tra questi vengono mappati il gene della corea di Huntington (1983), il gene per la distrofia muscolare (1987) e il gene per la fibrosi cistica (1989) Viene concesso il primo brevetto su una forma di vita geneticamente modificata, un microrganismo che si nutre di petrolio. Mullis inventa la tecnica della PCR Viene prodotto il primo animale transgenico Viene inventato il primo sequenziatore automatico Viene creato il National Center for Human Genome Research (NCHGR), guidato da James Watson per mappare e sequenziare tutto il DNA umano entro il 2005

5 Craig Venter crea l'Institute for Genomics Research Francis Collins assume la direzione del National Human Genome Research Institute (ex NCHGR) Viene pubblicata la prima sequenza completa del genoma di un organismo vivente diverso da un virus, il batterio Haemophilus influenzae Viene riportato il sequenziamento completo del primo organismo complesso, il lievito Saccharomyces cerevisiae Viene costruito il primo cromosoma umano artificiale e annunciata la clonazione di un mammifero, Dolly Viene proposto da diversi biologi molecolari, tra cui Renato Dulbecco, di sequenziare completamente il genoma umano Viene concesso il brevetto per un topo transgenico altamente suscettibile al tumore del seno.

6 Viene pubblicata una prima bozza della mappa del genoma umano, che mostra la localizzazione di più di geni. Viene pubblicata la sequenza completa del primo genoma di un animale, il verme Caenorhabditis elegans. Venter e la Perkin Elmer Corporation fondano la Celera Genomics con l'intento di sequenziare tutto il genoma umano in tre anni con il metodo del whole genome shotgun Viene pubblicata la sequenza completa del genoma di Drosophila melanogaster e viene annunciato dalla Celera Genomics il sequenziamento di tutte le basi nucleotidiche del DNA umano con il metodo whole genome shotgun.

7 Date storiche della sequenza del DNA 1869 Miescher osserva per la prima volta il DNA 1953 Watson e Crick determinano la struttura della doppia elica 1944 Avery propone il DNA come materiale genetico 1965 Holley sequenza il tRNA di lievito 1970 Vengono sviluppate le tecniche per la sintesi degli oligonucleotidi e per la degradazione chimica del DNA. Viene introdotta lelettroforesi su gel per la Separazione di frammenti di DNA 1980 Il DNA genomico viene clonato nel fago M13 o in vettori plasmidici, nascono i primi programmi informatici di analisi dei dati, vengono sviluppate nuove tecnologie per il sequenziamento 1977 METODO SANGER (terminazione di catena) METODO MAXAM-GILBERT (degradazione chimica) 1986 KARY MULLIS Introduce la PCR 1989 AUTOMAZIONE PARZIALE Vengono sviluppate le prime apparecchiature per il sequenziamento che impiegano sistemi per la rilevazione della fluorescenza Automazione completa Sequenziamento completo del genoma umano

8 Sequenziamento « Estrazione di DNA o RNA « PCR o amplificazione mediante clonaggio « Purificazione del campione di DNA « Cycle Sequencing « Precipitazione dei prodotti di cycle sequencing « Sequenziamento automatico « Analisi dei dati

9 Sequenziamento del DNA Metodi tradizionali ed odierni

10 Metodi di Maxam-Gilbert e di Sanger Hanno in comune la generazione di una scaletta di frammenti di DNA A singolo filamento, ciascuno più lungo del precedente di una base. Frammenti di dimensioni crescenti possono essere separati mediante Corsa elettroforetica su gel di poliacrilammide. A corsa ultimata il gel viene posto a contatto con una pellicola radiorafica Sulla quale lascia impressa la disposizione delle bande. Limmagine ottenuta, letta di seguito darà la sequenza delle basi.

11 Il metodo Maxam-Gilbert (o metodo di sequenziamento a degradazione chimica) Questo metodo, basato sulla degradazione chimica di frammenti di DNA a doppio filamento, è ormai poco utilizzato, perché non adatto al sequenziamento automatico e perché utilizza composti chimici dannosi alla salute Si differenzia da tutti gli altri metodi perché non utilizza sintesi enzimatiche ma trattamenti chimici che agiscono a livello di singoli nucleotidi. I frammenti di DNA a doppio filamento possono essere generati per frammentazione o digestione enzimatica. In entrambi i casi le molecole a doppio filamento devono essere convertite in molecole a singolo filamento e marcate terminalmente

12 « Marcatura terminale al 5 o al 3 del DNA a doppio filamento « Denaturazione e separazione dei due filamenti « Il DNA a singola elica viene suddiviso in quattro campioni, ognuno dei quali viene trattato con un reagente chimico che demolisce una o due delle 4 basi del DNA. G = DMS + piperidina G + A = DMS + piperidina + acido formico C + T = idrazina + piperidina C = idrazina + piperidina in NaCl 1,5 M « Le reazioni sono controllate in modo da avere una frammentazione parziale: statisticamente tutte le possibili basi saranno degradate producendo una serie di frammenti la cui lunghezza dipenderà dalla distanza tra lestremità marcata e il sito di taglio « Separazione dei frammenti marcati mediante gel elettroforesi e « Visualizzazione dei risultati mediante autoradiografia

13 Il metodo Maxam-Gilbert

14 Il metodo Sanger (o metodo a terminazione di catena) Il sequenziamento a terminazione di catena coinvolge la sintesi di nuovi filamenti di DNA, complementari ad uno stampo a singolo filamento Per la sintesi del DNA si utilizzano DNA polimerasi caratterizzate da Elevata processività Bassa attività esonucleasica 5-3 Bassa attività esonucleasica 3-5 (es. Klenow, Sequenasi)

15 Il metodo Sanger (o metodo a terminazione di catena) un innesco specifico (primer) La marcatura con un dNTP* marcato, di solito con 35 S Nel sequenziamento a terminazione di catena la reazione oltre ad Uno stampo a singola elica ha bisogno di:

16 5-A T C T T T T A G A G T A C C 3-T A G A A A A T C T C A T G G A C T C T C T A C T A T C T A C A T G T A -5 PRIMER DNA Polimerasi 5-A T C T T T T A G A G T A C C T G A G * A G A T G A T A G * A 3-T A G A A A A T C T C A T G G A C T C T C T A C T A T C T A C A T G T A -5 DNA Polimerasi PRIMER Sintesi del filamento marcato

17 Il metodo Sanger (o metodo a terminazione di catena) Nel sequenziamento a terminazione di catena la reazione oltre ad uno stampo a singola elica un innesco specifico (primer) la marcatura con un dNTP* marcato, di solito con 35 S ha bisogno di: una miscela di ddNTP, uno per ogni reazione di sequenza

18 La sintesi del filamento complementare, tuttavia non prosegue indefinitamente, perché la miscela di reazione contiene, in quattro distinte reazioni piccole quantità di specifici dideossi nucleotidi trifosfati, ddATP, ddTTP, ddCTP e ddGTP, che bloccano lallungamento perché posseggono un solo atomo di idrogeno al posto del gruppo -OH in 3 Terminazione della catena

19 ddCTP 5- A T C T T T T A G A G T A C C T G A G*A G A T G A T A G*A 3- T A G A A A A T C T C A T G G A C T C T C T A C T A T C T A C A T G T A -5 DNA Polimerasi PRIMER + ddNTP ( per es. ddCTP) 5- A T C T T T T A G A G T A C C T G A G*A G A T G A T A G*A T G T AddC 3- T A G A A A A T C T C A T G G A C T C T C T A C T A T C T A C A T G T A -5 STOP Il risultato è una serie di frammenti interrotti ciascuno in corrispondenza di ogni dCTP

20 DNA stampo a singola elica 3-GGCTAAC 53 Ibridazione con Il primer + [ 35 S]dATP+dCTP,dGTP,dTTP(dNTP)+Sequenasi ddATP, dNTP ddCTP, dNTP ddGTP, dNTP ddTTP, dNTP -CCG ddA -ddC -C ddC -CC ddG -CCGATT ddG -CCGA ddT -CCGAT ddT Sequenza: 5-CCGATTG A C G T -CCGATT ddG -CCGAT ddT -CCGA ddT -CCG ddA -CC ddG -C ddC -ddC GTGT T A G C C Schema di sequenziamento a terminazione di catena Direzione di lettura

21 Pratica ormai superata dal seq. automatico Marcatura Radioattiva Primer marcati con 32 P oppure 35 S dNTP Colorazione Silver Staining Evidenzia direttamente su gel le bande senza ulteriori modificazioni, attraverso la precipitazione di Ag Sequenziamento manuale

22 Nuovi metodi di sequenziamento Il sequenziamento a ciclo termico ( PCR asimmetrica) Il sequenziamento automatizzato con marcatori fluorescenti Il pirosequenziamento

23 1 Colorante - 4 Corsie Per ogni campione si eseguono 4 reazioni di estensione separate (una per ogni ddNTP) utilizzando un unico colorante Luso di 4 corsie aumenta però la variabilità di corsa Sequenziamento automatico

24 4 Coloranti - 1 Corsia Unica reazione ed unica corsa; Ad ogni nucleotide è associata una diversa colorazione: ddATP Questo sistema aumenta la produttività ed elimina la variabilità di corsa ddTTP ddGTP ddCTP Sequenziamento automatico

25 Il sequenziamento automatizzato con marcatori fluorescenti Coniugando a ciascun ddNTP un diverso marcatore fluorescente, è possibile effettuare le quattro reazioni di sequenziamento in un unico tubo da saggio e caricare il tutto in un solo pozzetto di gel ddA ddC ddT ddG

26 Metodi di Marcatura Marcatura dei Primers primers progettati con tag colorati a: Fluorescenza UV Fluorescenza IRminore Background maggiore Sensibilità Marcatura dei Terminatori ddNTPs marcati con fluorofori o differenti coloranti Sequenziamento automatico

27 Terminatori BigDye Sistemi a trasferimento di energia a singola molecola, costituiti da accettore e donatore legati da un linker Vantaggi: Segnale omogeneo, basso rumore di fondo, luminosità maggiore, facilità interpretativa per A e G attigue D A Sequenziamento automatico

28 Dalla cycle sequencing allelettroforetogramma...

29 Le emissioni fluorescenti vengono captate da un rilevatore e le informazioni vengono integrate e trasformate in picchi di colore diverso, con aree proporzionali allintensità di emissione.

30 Prevede lutilizzo di marcatura a fluorescenza rilevata automaticamente da un laser reazione e caricamento dei campioni sono eseguite manualmente Esistono kits in commercio che permettono di velocizzare e standardizzare tali operazioni fornendo mix di reazione, soluzioni di poliacrilammide a cui aggiungere soltanto Temed o gel preformati Sequenziatori a Gel Sequenziamento automatico

31 slab gel di poliacrilammide (dal 4% al 6%) molto sottili in condizioni denaturanti (Urea) Apparati verticali di lunghezza variabile a seconda del numero di basi da leggere (22 cm-1 m) Il forte campo elettrico a cui vengono sottoposti produce elevato calore che deve essere dissipato con piastre di alluminio o ventole Gel per elettroforesi

32 lintervento delloperatore è minimo il sistema carica automaticamente il capillare con il polimero di corsa esegue la separazione elettroforetica i frammenti marcati di DNA vengono rilevati man mano che corrono lungo il capillare Sequenziatori Capillari Sequenziamento automatico

33 Sequenziatori Capillari Richiede campioni privi di: sali, molecole cariche negativamente, proteine, detergenti e templates non marcati 1 Capillare 16 Capillari 96 Capillari (Scala di Produzione) Sequenziamento automatico

34 Sistemi di Rilevamento Camera CCD ( Charge - Coupled Device) Altissima risoluzioneImmagine Elettroferogramma Sequenza in pochi minuti Assenza di Filtri Uso di qualsiasi colorante Camera a Lettura Multipla Doppio Laser Doppio Rilevatore Es. NIR o SBS Sequenziamento automatico

35 Software Controlla e ottimizza i parametri elettroforetici Normalizza le bande Sottrae il background Corregge leffetto Smile Adatta gli algoritmi se mobilità e spaziatura dei picchi escono dal range Sequenziamento automatico

36 Possibili CausePossibili Soluzioni Il primer non trova sito di annealing Cambiare primer Il DNA presenta contaminazioni di vario tipo Ripreparare il DNA La quantità di DNA e' insufficienteAumentare la quantità di DNA La quantià di primer è insufficiente Aumentare la quantità di primer Il primer è stato disegnato male, es. temperatura di melting troppo bassa Ridisegnare il primer Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo

37 Possibili Cause Possibili Soluzioni Campione che presenta rumore di fondo sufficientemente alto da causare ambiguità (N) nel riconoscimento dei picchi da parte del software La quantità di DNA e' insufficiente e il segnale troppo debole Aumentare la quantità di DNA Il DNA presenta contaminazioni che inibiscono la reazione Purificare meglio il DNA Ci sono altri templati contaminantiRipreparare il DNA

38 Possibili CausePossibili Soluzioni Perdita di risoluzione precoce per cui i picchi sono sempre meno definiti Il DNA presenta contaminazioni che inibiscono la reazione Purificare meglio il DNA

39 Possibili CausePossibili Soluzioni Clone o PCR multiple con stesso tratto iniziale, es. vettore Ripreparare DNA in modo da avere un tipo di templato unico Siti multipli di attacco del primer sul DNA Cambiare primer Mutazione frame shift Slittamento dopo una regione omopolimerica Sequenza doppia dopo un tratto buono

40 Possibili CausePossibili Soluzioni Sequenza fuori scala Troppo DNA Riquantizzare e ridurre la quantità di DNA Struttura secondaria che blocca la reazione Pretrattare con DMSO

41 Possibili CausePossibili Soluzioni Regione ricca in GC Struttura secondaria che impedisce l'avanzamento della polimerasi perchè, per effetto dell'alta Tm del tratto di DNA, i due filamenti non si separano bene Sequenziare un prodotto di PCR amplificato sostituendo il 75% del dGTP con 7-deaza-dGTP Modificare il ciclo standard di sequenziamento con temperature più alte

42 Sequenziamento automatico: Applicazioni in ambito biomedico

43 Sequenziamento di DNA o cDNA sconosciuto ( es. per caratterizzare regioni del DNA e trascritti genici precedentemente localizzate con analisi di linkage) Primer walking Shotgun sequencing utilizzo di vettori di clonaggio Sequenziamento di DNA o cDNA conosciuto per analisi mutazionale utilizzo di PCR Vettori fagici a singolo filamento Vettori plasmidici a doppio filamento Vettori fagomidici Vettori per grossi inserti di DNA

44 Mapping Tecnica del Chromosome Walking Sequenziamento di Library Progetto Genoma

45 Sequenziamento Ex Novo Uso di Primers Universali Es. M13 Sfrutta lOverlapping dei vari frammenti Assemblaggio ed Allineamento delle sequenze tramite Computer Tecnica del Random Sequencing

46 Le finalità principali del progetto genoma riguardano l'acquisizione i informazioni utili per individuare l'eventuale implicazione di alterazioni nella sequenza del DNA nello sviluppo di patologie genetiche nell'uomo, e per comprendere le basi genetiche dell'evoluzione e del funzionamento dell'organismo umano

47 Sintesi di Oligonucleotidi Probe per Microarray Oligonucleotidi antigene/antisenso analisi dellespressione genica farmacogenomica SNPs

48 Dare un senso ai dati di sequenza non è facile!! Isole CpG: la citosina può essere metilata nei geni inattivi Sequenze di siti di splicing in 5 e 3: come marcatori per gli introni e le zone di confine con gli esoni ORF: mRNA CUUAGCGUAGCUACUAGACUAG fase 1 CUU/AGC/GUA/GCU/ACU/AGA/CUA/G fase 2 CU/UAG/CGU/AGC/UAC/UAG/ACU/AG fase 3 C/UUA/GCG/UAG/CUA/CUA/GAC/UAG Open reading frame

49 Perché sequenziare anche organismi diversi da Homo Sapiens? Ad esempio per confrontare le sequenze altamente conservate, è più probabile che codifichino proteine funzionalmente importanti

50 Sequenziamento di DNA o cDNA sconosciuto ( es. per caratterizzare regioni del DNA e trascritti genici precedentemente localizzate con analisi di linkage) Primer walking Shotgun sequencing utilizzo di vettori di clonaggio Sequenziamento di DNA o cDNA conosciuto per analisi mutazionale utilizzo di PCR Vettori fagici a singolo filamento Vettori plasmidici a doppio filamento Vettori fagomidici Vettori per grossi inserti di DNA

51 Comparativa e/o Mutazionale Uso Diagnostico Implicazioni Terapeutiche Applicazione non di routine Monitoraggio pazienti in terapia Test di Genotyping Es. HIV

52 Dimensione della mutazione Genoma Cromosoma Gene Poliploidie Aneuploidie Riarrangiamenti cromosomici Piccole delezioni/duplicazioni Delezioni/duplicazioni geniche Delezioni/duplicazioni nucleotidiche Mutazioni nucleotidiche Bandeggio cromosomico Fish di interfase Fish cromosomica Genetica molecolare Sequenziamento

53 Mutazione di un singolo nucleotide

54 Mutazioni per inserzione o delezione di nucleotidi in eterozigosi

55 Sequenziamento del tratto nucleotidico delle immunoglobuline (Ig) relativo al riarrangiamento della regione variabile CDR3 specifica del clone tumorale, da utilizzare in neoplasie linfoidi di tipo B per il monitoraggio della malattia minima residua e come base per la produzione di vaccini anti-idiotipici paziente-specifici.

56 Sequenziamento della VH-CDR3 Pession et al, Leuk Lymphoma 2003

57 Sequenziamento regione CDR3 del TCR per caratterizzazione cloni di linfociti T in vitro/vivo CDR 3 REGIONI CHE DETERMINANO LA COMPLEMENTA RIETA

58 Sequenziamento regione CDR3 del TCR per caratterizzazione cloni di linfociti T in vitro/vivo Montagna et al int.j of cancer 2004

59

60 Genotipizzazione del genoma virale del lentivirus HIV, responsabile della sindrome da immunodeficienza acquisita umana (AIDS) una delle caratteristiche di questo virus è quella di andare in contro spesso a mutazioni casuali nel proprio genoma. ne consegue la selezione di ceppi resistenti ai farmaci

61 HIV ViroSeq Kit (Applied Biosystems Inc.) TRUGENE TM HIV-1 Genotyping Kit (Visible Genetics Inc) Individuazione Resistenze farmaci in pazienti non rispondenti

62 Software allinea sequenza con WT Rileva Mutazioni Accesso a Banca Dati Regole che correlano singole o combinazioni di mutazioni al grado di resistenza per ogni farmaco HIV

63 Valutazione dello stato di metilazione di un gene ed in particolare del suo promotore Tecnica del bisufilto Il trattamento con bisulfito converte le citosine non metilate in timine Le citosine metilate (quelle delle isole CpG) rimangono tali Attenzione nel progettare i primers !! (escludere le parti con CpG) Decitabina: demetilante inibendo la DNA metil-transferasi Dott.ssa Formica, dott.ssa Dan, lab. Oncoped. LAM in particolare con riarrangemento di MLL

64 Elenco dei siti che contengono informazioni sul Progetto Genoma Umano e sui frammenti di DNA sequenziati.

65 Il clonaggio dellintero genoma umano non è difficile tecnicamente e sono disponibili genoteche in fagi od in cromosomi artificiali di lievito abbastanza ampie da contenere diverse volte il genoma umano; ma il DNA di queste genoteche è stato clonato in modo casuale dal genoma. Perché abbia un senso il DNA in questi cloni deve essere strutturato nellordine corretto, in modo da poter ricostruire il genoma, o suoi frammenti che siano abbastanza ampi da contenere porzioni di sequenze biologicamente interessanti.

66 Sospetto clinico (sintomatologia, storia familiare) Isolamento dal sangue periferico di linfociti circolanti Analisi del cariotipo Estrazione del DNA Amplificazione tramite PCR Diagnosi citogenetica Southern blot Corsa su gel SSCP sequenziamento RFLP Creazione o distruzione di un sito di restrizione diagnosi di delezioni inserzioni duplicazioni identificazione di nucleotidi alterati diagnosi di specifiche mutazioni puntiformi


Scaricare ppt "UN PO DI STORIA... 1900 - Riscoperta delle leggi della trasmissione ereditaria dei caratteri, che Mendel aveva pubblicato nel 1865 e che avevano come."

Presentazioni simili


Annunci Google