La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

PCR - REAZIONE a CATENA della POLIMERASI E IL mezzo per produrre in vitro grandi quantità di una specifica sequenza di DNA, partendo da DNA estremamente.

Presentazioni simili


Presentazione sul tema: "PCR - REAZIONE a CATENA della POLIMERASI E IL mezzo per produrre in vitro grandi quantità di una specifica sequenza di DNA, partendo da DNA estremamente."— Transcript della presentazione:

1 PCR - REAZIONE a CATENA della POLIMERASI E IL mezzo per produrre in vitro grandi quantità di una specifica sequenza di DNA, partendo da DNA estremamente complesso. Primer a RNA Nuovo filamento DNA polimerasi DNA stampo Nuovo filamento Primers a RNA Il principio a cui si ispira la PCR è la replicazione del DNA: REPLICAZIONE DNA stampo PCR 1 1 x 10 9 PCR DNA 3 Primer oligonucleotidico 5 3 DNA polimerasi termostabile Nuovo filamento

2 Le FASI della PCR Allungamento (~ 70°C) Denaturazione (~ 95°C) Annealing (~ 60°C) DENATURAZIONE: Il DNA viene denaturato mediante riscaldamento in provetta a ~ 92-95°C ANNEALING: La miscela viene raffreddata fino a raggiungere la temperatura che garantisce la specifica ibridazione dei primers alle regioni dello stampo ad essi complementari ALLUNGAMENTO: La temperatura della miscela viene portata a 68-72°C consentendo alla DNA polimerasi termostabile di sintetizzare il filamento complementare allo stampo a partire dallinnesco oligonucleotidico

3 5 3 primer primer 2 i filamenti vengono separati ed i primers si appaiano i primers si estendono 35 complementarietà al primer complementarietà al primer 2 i filamenti vengono separati ed i primers si appaiano i primers si estendono filamenti di lunghezza omogenea filamenti di lunghezza variabile regione di interesse 3 5 complementarietà al primer 1 complementarietà al primer 2 i filamenti vengono separati ed i primers si appaiano i primers si estendono I°step II°step III°step Frammenti desiderati (quelli di lunghezza variabile non sono mostrati) E così via PCR

4 I primi 4 cicli della PCR in dettaglio DNA stampo Frammento desiderato 1° ciclo 2° ciclo 3° ciclo 4° ciclo 35° ciclo Amplificazione esponenziale 2 1 = 22 2 = = 82 4 = Numero di copie di DNA contenenti il frammento desiderato Numero di copie di DNA della corretta lunghezza contenenti il frammento desiderato 00 28

5 PROGETTAZIONE dei PRIMERS Caratteristiche di un buon primer: Una sequenza di 16 bp sarà statisticamente presente solo una volta ogni 4 16 bp (~ 4 miliardi di basi) corrispondenti circa alla grandezza del genoma umano. Lunghezza: 16 bp o più La T m dipende dalla lunghezza e dalla sequenza del primers T m = 4(G+C)+2(A+T)°C ~ 2-5°C al di sotto della più bassa T m dei due primers usatiT annealing T m primer 1 T m primer 2 ~ Se la T a dei due primers è molto diversa si possono verificare amplificazioni asimmetriche o a singolo filamento. Assenza di sequenze ripetute invertite che possano far ripiegare il primers su se stesso o di sequenze complementari fra i primers che causano lamplificazione di dimeri dei primers

6 PROGETTAZIONE COMPUTERIZZATA dei PRIMERS rev for GTGTGCGTACAGCGCAAC GGGTGGGACCTGGGCGCCCCCGCCGTGAGCGCCTACTGCTCCACCTGGGACGCCGGCAAGCCGTACTCG Primer REV Primability of Match = 71% Stability of Match = 44% Primer REV Primability of Match = 100% Stability of Match = 81% CATGCATGATGCTCAAATGCCGCATTGTTGCGCTGTACGCACACATGTATGAATGCATGGCACGGATCAA GTTGCGCTGTACGCACAC -53- GGACACGTATGCCACAGCCC TGCTAAATTTTCCAGCTAGGTAGCAGGACACGTATGCCACAGCCCTTAAAAGCATATCTGCACATGTCTT Primer FOR Primability of Match = 100% Stability of Match = 82%

7 ...PROGETTAZIONE COMPUTERIZZATA dei PRIMERS CTTTTGGCATAGACCACATGCCA 5 TGTTACAAGTGTGGATGGATGCC 5 GGCCAGTGAATTCAGCTCACGCCCCAAATATGCAGCTTCCAGTCCAGTTTCATCCGGCG CGCTGAAGATTTTTTAGAGCATGCTCTATTATGCAGCGTCCGTTGGAATGCTCTTTTTAAC TCCGCGCGCGCTAAACTTGCGATTTTTTGGGCGCGGCGCTGATATTGGGCGTCTGTTGA AGATGCTCTTAAGTGGCCACAAGGGAGATGGGTCGGGCTAAGGTTTCATATCTTACAATA TAAAGTTGAAGACGATTTGTGGCACCCAGGGGCGGGAGACGCATGCATGCAGCTGCATG ATTGCACCAAGATCCGAAGAGTGGTTTATGGTTTGAGCTTAATTACTGCATGCATGCAAC TTTTTGGTACAACTTTTGGCATAGACCACATGCCATCCCACCTCCCATGCTTTTCATTTTT ACTTGTAAATTTGGATCTATTATATCTTTTGAATCAAAAGTTCAATTTATATTTCGTTTGCGT ATTCTTGTCCCTTGTGTCGAGAGCTTTGAAACAAGCCCACTTTTGAATACGTTTTGACAAA TTCTAAAAACTTAAGTGAGTTTCAACTGCTAAAACTTGATAGAATGAATGAAAAATTTAGC AAGTTTCAAAGACTAAAACTGAAACCCTAAGCCCTTAGCCCTAGATCCTAAGCCCTAAGC CGGAAGTCCTAAACCGTATGCCCCTAACA T m = 58.6 T m = 56.1 T m = 83.6 ?Clear Open fileCalculate Minimum stem size: Minimum 3 overlap: 4 2 Optimal annealing temperature is end of oligo 1 pairs to positions 5 to 10 of itself.

8 COMPONENTI di una REAZIONE di PCR Stampo DNA a doppio filamento Deossiribonucleotidi trifosfati Miscela equimolare di dATP, dTTP, dGTP, dCTP Primers Oligonucleotidi complementari a regioni dei filamenti opposti che fiancheggiano la sequenza DNA bersaglio Tampone contenente cloruro di magnesio Lo ione Mg 2+ è essenziale per il funzionamento dellenzima Enzima Tradizionalmente viene usata la Taq polimerasi, enzima termostabile estratto dal batterio termofilo Thermus aquaticus dNTP Mg 2+

9 I FATTORI CRITICI della PCR …nella miscela di reazione Non utilizzare quantità eccessive di stampo, primers e/o dNTP al fine di evitare amplificazioni non specifiche. Dosare accuratamente la [Mg 2+ ] in funzione della quantità di stampo, primers e dNTP utilizzata Mg 2+ è indispensabile al funzionamento della Taq polimerasi, ma è chelato da stampo, primers e dNTP. Se in eccesso causa una perdita di fedeltà da parte dellenzima. Selezionare lenzima più idoneo alle proprie necessità Emivita alla temperatura di denaturazione Processività Capacità di correzione degli errori Taq, Pfu...

10 I FATTORI CRITICI della PCR …nella programmazione 94°C 1 72°C 1 Emivita Taq polimerasi: 30 min a 95°C ~ 30 cicli di denaturazione di 1 min T DEN 95°C o N. cicli 30 Diminuire il tempo di denaturazione/ciclo TEMPERATURA e TEMPO di DENATURAZIONE 91-97°C a seconda della complessità dello stampo Quindi, se: 60°C 30 TEMPERATURA e TEMPO di ANNEALING T ANN troppo bassa amplificazione aspecifica T ANN troppo altaamplificazione con bassa resa T ANN ~ T MELTING o primers lunghi Allungare il tempo di annealing TEMPERATURA e TEMPO di ALLUNGAMENTO TEMPERATURA: 68-72°C a seconda dellenzima TEMPO: 1min / Kb di amplificato ALLUNGAMENTO FINALE di 7-10 min per completare la sintesi degli eventuali prodotti parziali NUMERO di CICLI Dipende da [stampo] iniziale 3x10 5 molecole iniziali cicli 50 molecole iniziali cicli N.B.Dopo cicli: - lattività dellenzima si riduce - primers e dNTP si esauriscono

11 STRATEGIE per AUMENTARE la SPECIFICITA TOUCHDOWN PCR Den. 30 sec 94°C Ann. 30 sec T m (+5°C) -1°C/ciclo All. 1 min/Kb 72°C 10 cicli Den. 30 sec 94°C Ann. 30 sec T m (-5°C) All. 1 min/Kb 72°C 20 cicli Den. iniziale 3-5 min 94°C 1 ciclo All. finale 7 min72°C 1 ciclo Manteni- mento 4°C Den. 30 sec 94°C Ann. 30 sec T m (-5°C) All. 1 min/Kb 72°C 30 cicli Den. iniziale 3-5 min 94°C 1 ciclo All. finale 7 min72°C 1 ciclo Manteni- mento 4°C PCR CLASSICA

12 ...STRATEGIE per AUMENTARE la SPECIFICITA HOT STARTNESTED PRIMER PCR La PCR hot start previene la formazione di questi prodotti non specifici in quanto un componente chiave della miscela di reazione (enzima o MgCl 2 ) viene aggiunto dopo lo step di denaturazione iniziale. Durante lallestimento della reazione di PCR o durante il riscaldamento iniziale del campione si possono verificare situazioni di appaiamento non specifico fra primers e stampo. Fra 40 e 50°C la Taq polimerasi ha unefficiente attività polimerasica e può estendere i primers non correttamente appaiati. Perché realizzare una PCR hot start? NOVITA: Enzimi Hot start Gocce di cera Procedura: Lamplificazione è realizzata con un set di primers Il prodotto è riamplificato con un set di primers interni ai precedenti I prodotti non specifici amplificati nella I a PCR non saranno amplificati nella II a I a PCR II a PCR pr. nested

13 T T r CLONAGGIO dei PRODOTTI di PCR La Taq e altre polimerasi hanno unattività trasferasi-terminale che conduce allaggiunta di un singolo nucleotide allestremità 3 dei prodotti di PCR. In presenza dei 4 dNTPs è preferenzialmente aggiunto dA. 5 A A I prodotti di PCR possono quindi essere agevolmente clonati in plasmidi aperti che contengono un deossitimidin nucleoside (dT) alle estremità 5. Siti di clonaggio multiplo

14 APPLICAZIONI della PCR Produzione di sonde oligonucleotidiche PCR Clonaggio e manipolazione dei geni PCR Tipizzazione dei geni e del DNA: -caratterizzazione di ricombinanti batterici -diagnosi cliniche -analisi di campioni biologici in medicina legale PCR Mutagenesi casuale o sito-specifica PCR

15 CLONAGGIO e MANIPOLAZIONE di GENI STRATEGIA Presentano varie opzioni a certe posizioni della sequenza rendendo possibile lannealing e lamplificazione di sequenze omologhe da organismi differenti Primers degenerati R = A, GH = A, C, T Y = C, TB = C, G, T W = A,TV = A, C, G M = A,CD = A, G, T K = G, TN o I= A, C, G, T S = C, G Sequenza genica nota Caso 1:Caso 2: Sequenza genica omologa nota o sequenza proteica nota Si amplifica il gene desiderato direttamente dal DNA genomico o dallRNA Si disegna un primer specifico Si disegna un primer degenerato N.B. I primers possono essere disegnati in maniera tale da contenere al 5 la sequenza di specifici siti di restrizione che possono essere sfruttati per linserimento dei prodotti di PCR nei vettori di clonaggio. 5-TCGAATTCNCCYAAYTGNCC-3 EcoRI

16 Sintesi primo filamento cDNA AAAAA-3 7-mG Aggiunta coda omopolimera al primo filamento cDNA Trasferasi terminale + dATP Trascrittasi inversa + GSP1 GSP1 5 3-AAAAAAAAA Sintesi secondo filamento cDNA AAAAA-3 7-mG mRNA GSP1 5 3-AAAAAAAAA GSP1 TTTTT P GSP1 complementarietà al primer GSP1 complementarietà al primer P(dT) TTTT P TTTTTP GSP1 I° gruppo di amplificazioni AAAAAP GSP13 TTTTTP GSP1 5 3 II° gruppo di amplificazioni TTTTTP GSP1 5 3 GSP2 5AAAAAP GSP13 TTTTTP 5AAAAAP 3 GSP2 TTTTTP 5 3 GSP2 Prodotto PCR finale 5 - RACE Rapid Amplification Complementary Ends

17 3 - RACE Rapid Amplification Complementary Ends Sintesi primo filamento cDNA AAAAAAAA-3 7-mG Trascrittasi inversa + P(dT) AAAAAAAA-3 7-mG mRNA TTTTT P Sintesi secondo filamento cDNA GSP1 complementarietà al primer P(dT) I° gruppo di amplificazioni TTTTT P 5 3 complementarietà al primer GSP1 5 AAAAAP3 TTTTT P GSP1 5 3 TTTTT P GSP1 5 3 GSP2 5 GSP1 AAAAAP3 TTTTT P GSP25 AAAAAP3 53GSP2 TTTTT P II° gruppo di amplificazioni Prodotto PCR finale

18 MUTAGENESI CASUALE In che modo delle mutazioni nel gene influenzano la funzione del prodotto? ? ER OR PRONE PCR R PREMESSA: La frequenza di errore delle DNA polimerasi è ~ allo 0,001 (una base ogni 10 6 nucleotidi) grazie ad unattività corretrice 3 5 che rimuove i nucleotidi male incorporati. E possibile indurre laumento di errori nella PCR utilizzando: Taq polimerasi prive di attività correttrice Basse temperature di annealing che diminuiscono la fedeltà Ineguali concentrazioni dei dNTP Elevate concentrazioni di MgCl 2 Alto numero di cicli (60-80) Amplificazioni successive del prodotto di PCR

19 primer con differenza di un solo nucleotide sequenza bersaglio nucleotide originale nucleotide cambiato LEGENDA DNA lineare amplificato DNA plasmidico circolare con incisure e nucleotide cambiato PCR Filamento 1 Filamento 2 Filamento 3 Filamento 4 Filamento 1 Filamento 3 Filamento 2 Filamento 4 Denaturazione, rinaturazione Trasformazione di E. coli MUTAGENESI SITO-SPECIFICA

20 Amplificazione sequenza bersaglio + quantificazione dellespressione genica identificazione del prodotto di amplificazione specifico rispetto a prodotti aspecifici analisi simultanea di due campioni nella stessa reazione individuazione di mutazioni puntiformi … on-line e in tempo reale! REAL-TIME PCR

21 LigthCycler SYSTEM Caratteristiche: Come mezzo di trasmissione della temperatura dalla resistenza ai campioni viene utilizzata laria che, essendo virtualmente senza massa, rende questo processo molto veloce. Le reazioni vengono preparate in capillari di vetro borosilicato che, avendo un alto rapporto superficie:volume, assicurano una rapida equilibrazione fra laria ed i componenti della reazione. Una reazione di PCR di cilci può essere completata in min. Rapide variazioni di temperatura durante i cicli termici Monitoraggio on-line e simultaneo dellamplificazione dei vari campioni mediante sistemi di rilevamento della fluorescenza Roche

22 ...LigthCycler SYSTEM resistenza capillari (max 32) camera termica filtri LED ventilatore canali di rilevamento fluorimetrico Lunità ottica è dotata di un LED come sorgente di luce e di tre canali di rilevamento che misurano la luce emessa a tre differenti lunghezze donda: 530 nm 640 nm 710 nm I valori di fluorescenza rilevati vengono visualizzati sullo schermo del computer consentendo il monitoraggio on-line della reazione di PCR. Lintensità del segnale prodotto dal fluoroforo è proporzionale alla quantità del prodotto di PCR. Numero di cicli Fluorescenza Laumento dellintensità del segnale inizia a cicli differenti a seconda della concentrazione iniziale del DNA bersaglio.

23 SYBR Green E un colorante fluorescente che si lega solo al DNA a doppio filamento ed emette la fluorescenza solamente in queste condizioni. DENATURAZIONE Non viene rilevata fluorescenza Lintensità della fluorescenza comincia ad aumentare ANNEALING ALLUNGAMENTO Lintensità della fluorescenza continua ad aumentare e diventa massima al termine della fase di allungamento LAUMENTO DELLA FLUORESCENZA E REGISTRATO A 530 nm SYBR Green Primer Luce emessa Polimerasi

24 SONDE di IBRIDAZIONE Due sonde oligonucleotidiche sequenza-specifiche, marcate con coloranti diversi, ibridizzano con la sequenza bersaglio sul filamento di DNA amplificato in un arrangiamento testa-coda che consente lemissione della fluorescenza. DENATURAZIONE Non viene rilevata fluorescenza: il colorante donatore è eccitato dalla sorgente ed emette energia in grado di eccitare laccettore solo se la distanza fra i due è pari a 1-5 nucleotidi Colorante donatore Colorante accettore ANNEALING Viene registrata la massima fluorescenza LAUMENTO DELLA FLUORESCENZA E REGISTRATO A 640 nm Oligo 1 Fluoresceina Oligo 2 LC Red 640 Prodotto di amplificazione Eccitazione Emissione Trasferimento 1-5 nucleotidi

25 ANALISI della CURVA di MELTING Consente di identificare il prodotto di amplificazione specifico rispetto a prodotti aspecifici. Al termine della PCR la temperatura viene lentamente aumentata inducendo un decremento della fluorescenza. La temperatura in corrispondenza della quale si ha un repentino decremento della fluorescenza corrisponde alla T m del prodotto. Curva di fluorescenza copie 10 copie 10 4 copie Fluorescenza Cicli di amplificazione copie 10 copie 0 copie Temperatura (°C) Fluorescenza Curva di melting Derivata negativa della curva di melting Temperatura (°C) -dF/dT TM 10 4 copie 10 copie 0 copie prodotti non specifici

26 QUANTIFICAZIONE del PRODOTTO di PCR Identificando il primo ciclo della PCR in corrispondenza del quale inizia lamplificazione esponenziale del prodotto è possibile quantificare la concentrazione iniziale del DNA bersaglio copie Numero cicli Fluorescenza Curva di fluorescenza di campioni a concentrazione nota Estrapolazione della curva standard N. cicli Log concentrazione 10 4 copie linea di base La linea di base identifica il ciclo in corrispondenza del quale inizia laumento esponenziale della fluorescenza per ciascun campione. Riportando in grafico il valore di intersezione con la linea di base in funzione del Log della concentrazione iniziale di ciascun campione si ottiene la curva standard da cui si può estrapolare il valore della concentrazione di campioni a titolo ignoto.

27 MULTIPLEX PCR Fluorecseina LC Red 640 Fluorecseina LC Red 705 Consente lanalisi simultanea di due campioni nella stessa reazione Due coppie di Sonde di Ibridazione, ciascuna specifica per un prodotto di amplificazione, vengono marcate con un diverso colorante accettore che emette la fluorescenza a differenti lunghezze donda. STRATEGIA: Il segnale emesso viene letto simultaneamente attraverso due canali di rilevamento fluorimetrico. Canale nm Canale nm Eccitazione Trasferimento Emissione

28 ANALISI di MUTAZIONI PUNTIFORMI Sfrutta differenze nella T m di Sonde di Ibridazione perfettamente legate al DNA bersaglio o il cui legame è destabilizzato dalla presenza di basi non appaiate. gene mutato La Sonda 1 si ibridizza alla parte della sequenza bersaglio mutata La Sonda 2 si ibridizza alla parte della sequenza bersaglio non mutata gene selvatico Sonda 1 marcata con Fluoresceina Sonda 2 marcata con LC Red 640 Al termine della PCR si analizza la curva di melting: se è presente una mutazione, la T m dellibrido sarà più bassa che in assenza di mutazione. Temperatura omozigote wildtype omozigote mutante eterozigote Fluorescenza Temperatura dF/dT

29 LETICHETTATURA nei REGOLAMENTI C.E.E. Disciplina la vendita di prodotti contenenti OGM destinati al consumo umano ed introduce la nozione di sostanziale equivalenza : due alimenti sono considerati sostanzialmente equivalenti quando non presentano alcuna differenza dal punto di vista nutrizionale, organolettico e della sicurezza. Rende inoltre obbligatoria letichettatura degli alimenti transgenici che non siano sostanzialmente equivalenti ai prodotti convenzionali. REGOLAMENTO 258/97 sui Novel Food REGOLAMENTI COMUNITARI 49 E 50/2000 Prevedono lobbligo di etichettatura per tutti gli alimenti che contengano ingredienti (49/2000), additivi e aromi (50/2000) derivanti da organismi geneticamente modificati. Lobbligo non vale se il prodotto risulti accidentalmente contaminato da derivati di organismi geneticamente modificati in una percentuale non superiore all1%.

30 DIAGNOSTICA degli OGM negli ALIMENTI TEST sulle PROTEINE Rilevazione immunologica della proteina codificata dal transgene (ELISA) - Quali- / quantitativo - Rapido - Test da campo Richiede materie prime non lavorate Lespressione delle proteine è spesso tessuto-specifica e sviluppo-dipendente - - TEST sul DNA Ricerca del transgene e di sequenze ad esso correlate (Real-time PCR) - Quali- / quantitativo - Rapido - Sensibile (limite = %) - Degradazione del DNA - Presenza di inibitori della polimerasi Possibili contaminazioni con DNA estraneo Non tutti i derivati alimentari contengono DNA (es. olio di semi di mais) - -

31 Analisi qualitativa (screening) I° STEP Rivela la presenza/assenza dellOGM nel campione Si ricerca la presenza di sequenze regolatrici comuni alla maggior parte degli OGM risultato positivo Si identifica il transgene presente, verificando se è uno di quelli autorizzati in commercio risultato negativo Lanalisi si arresta Nessun transgene autorizzato Alimento illegale Transgene autorizzato II° STEP Analisi quantitativa Se i singoli ingredienti superano la percentuale dell1% scatta lobbligo di riportarne la presenza in etichetta ITER per il RILEVAMENTO di OGM negli alimenti mediante TEST sul DNA

32 GENI BERSAGLIO nellanalisi qualitativa degli alimenti Individuazione del transgene Elementi caratteristici dei costrutti ricombinanti Promotore CaMV 35S Transgene tNOS Gene marcatore Promotore CaMV 35S tNOS Gene marcatore PCR QUALITATIVA Amplificazione di una delle seguenti sequenze: Amplificazione di geni sicuramente presenti nel campione (es. lectina della soia, zeina del mais) PCR QUANTITATIVA (è disponibile una banca dati che contiene tutte le sequenze di DNA depositate nei brevetti a livello mondiale)

33 2 ESEMPI di QUANTIFICAZIONE... La soia Roundup Ready (Monsanto) è stata modoficata geneticamente per resistere alla somministrazione del glifosato, un diserbante ad ampio spettro. Soia Roundup Ready Per quantificare mais e soia transgenici negli alimenti sono state opportunamente disegnate combinazioni di Sonde di Ibridazione che riconoscono tanto il transgene quanto un gene endogeno, rendendo possibile quantificare simultaneamente sia il contenuto di mais/soia GM che di mais/soia totale nel campione in analisi. Sonda 1 specifica per il transgene cryIA(b), codificante per la tossina Sonda 2 specifica per il gene endogeno codificante per lenzima invertasi Sonda 1 specifica per il transgene CP4-EPSPS Sonda 2 specifica per il gene endogeno codificante per la lectina Mais Bt di un gene che codifica per una tossina insetticida Il mais-BT è stato reso resistente alla piralide mediante linserimento derivata dal batterio Bacillus turingiensis la cui ingestione provoca la morte delle larve paralizzandone lintestino.


Scaricare ppt "PCR - REAZIONE a CATENA della POLIMERASI E IL mezzo per produrre in vitro grandi quantità di una specifica sequenza di DNA, partendo da DNA estremamente."

Presentazioni simili


Annunci Google