La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Lo studio del genoma umano aiuta lo studio degli altri genomi Vincenzo Nigro Dipartimento di patologia generale, Seconda Università degli Studi di Napoli.

Presentazioni simili


Presentazione sul tema: "Lo studio del genoma umano aiuta lo studio degli altri genomi Vincenzo Nigro Dipartimento di patologia generale, Seconda Università degli Studi di Napoli."— Transcript della presentazione:

1 Lo studio del genoma umano aiuta lo studio degli altri genomi Vincenzo Nigro Dipartimento di patologia generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine

2 57 anni fa

3 Prima reazione di PCR Parte il progetto GENOMA UMANO Costo giornale £ 650 Tazzina Caffè £

4 Cos'è il genoma? Il genoma è l'intero patrimonio genetico di un organismo vivente. Si può paragonare ad un'enorme enciclopedia in cui sono contenute le istruzioni che regolano lo sviluppo e il funzionamento dell'organismo Il genoma è "scritto" in un composto chimico chiamato DNA (DeoxyriboNucleic Acid, acido desossiribonucleico) Il DNA è identico per tutte le cellule di un individuo ed è contenuto nel nucleo

5

6 Timeline of large-scale genomic analyses

7 La grandezza totale del genoma umano aploide è di basi di cui sono di eucromatina

8 1245,203,898218,712, ,315,028237,043, ,411,731193,607, ,610,523186,580, ,967,295177,524, ,740,541166,880, ,431,299154,546, ,908,738141,694, ,505,819115,187, ,480,874130,710, ,978,784130,709, ,464,434129,328, ,151,65695,511, ,311,21687,191, ,114,05581,117, ,995,99979,890, ,691,21677,480, ,753,51074,534, ,790,86055,780, ,644,86859,424, ,976,53733,924, ,476,97234,352,051 X152,634,166147,686,664 Y50,961,09722,761,097

9

10

11

12

13 UCSC Genome Browser Screenshot from University of California at Santa Cruz Human Chimp Orangutan Rhesus Marmoset Mouse Rat Guinea Pig Dog Horse Cow Opossum Platypus

14

15 Cromosomi umani con i colori dei corrispondenti cromosomi di topo

16 comparazione delle sequenze tra il cromosoma 21 umano e 3 cromosomi sintenici di topo sea Mb 1.6 Mb 2.6 Mb Mouse 25.7 Mb Human 33.5 Mb ~75 My ~300 My ~450 My

17 La distribuzione dei geni nel nucleo non è casuale

18 Numero di geni per segmenti conservati tra uomo e topo

19 Human Genome sea3093 CNC= conserved non coding sequences

20

21

22 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA Variazioni della sequenza del DNA

23 NH 2 N N N N N NH OO H3CH3CH3CH3C Cytosine 5-methylcytosineThymine metilazionedeaminazione O O CG TG CG CA Il meccanismo più comune di mutazione

24 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA variazioni di sequenza del DNA patologiche predisponenti neutre

25 Mutazioni dei codoni umani (mutazioni independenti nei geni F8, F9, L1CAM, OTC, BTK)

26 5 effetti di un allele amorfo e ipomorfo causati dalle delezioni nullo o amorfo = nessun prodotto genico ipomorfo = ridotta quantità/attività ipermorfo = aumentata quantità/attività neomorfo = nuova quantità/attività antimorfo = quantità/attività antagonistica (dominante negativo)

27 dominanza e recessività in genetica, il carattere (o lallele) è dominante se leterozigote è indistinguibile dallomozigote in medicina la malattia è: –dominante: fenotipo clinicamente manifesto con 1 allele mutato –recessiva: fenotipo clinicamente manifesto con 2 alleli mutati (omozigote o eterozigote composto)

28

29 geni umani codificanti proteine … con mutazioni che causano malattie genetiche 7jan = 10.5% geni umani ipotetici, pseudogeni o altro non ancora associati a malattie genetiche

30 DogCowCatPigHorseSheepChickenGoatRabbitOtherTOTAL Total Phenes Single-locus phenes Phenes ch. at the molecular level Potential models for human disease Potential model in other animals Online Mendelian Inheritance in Animals (OMIA) is a database of genes, inherited disorders and traits in more than 135 animal species (other than human and mouse, which have their own resources). The database contains textual information and references, as well as links to relevant PubMed and Gene records at the NCBI

31 Simple search for: "muscular dystrophy" 10 records found OMIA Muscular dystrophy in Gallus gallus (chicken) OMIA Muscular dystrophy in Gallus gallus (chicken) Sub-type: Abnormal muscle; AM Genes: WWP1 OMIA Muscular dystrophy in Canis familiaris (dog) OMIA Muscular dystrophy in Ovis aries (sheep) OMIA Muscular dystrophy in Meleagris gallopavo (turkey) OMIA Muscular dystrophy in Mustela lutreola (European mink) OMIA Muscular dystrophy in Felis catus (cat) OMIA Muscular dystrophy, Duchenne and Becker types in Felis catus (cat) OMIA Muscular dystrophy, Duchenne and Becker types in Felis catus (cat) Genes: DMD OMIA Muscular dystrophy, Duchenne and Becker types in Canis familiaris (dog) OMIA Muscular dystrophy, Duchenne and Becker types in Canis familiaris (dog) Sub-type: X-linked muscular dystrophy OMIA Muscular dystrophy, dysphagia-associated in Canis familiaris (dog) OMIA Progressive muscular dystrophy in Mustela lutreola (European mink European mink )

32 SNPs single nucleotide polymorphisms Variazioni puntiformi della sequenza tra due copie del genomaVariazioni puntiformi della sequenza tra due copie del genoma Per un SNP un individuo può esserePer un SNP un individuo può essere –Omozigote T/T o C/C –Eterozigote T/C

33 hss33 Aplotipi dei polimorfismi del DNA e origine delle mutazioni origine differentestessa origine Mutazione Polimorfismo del DNA

34 SNPs nel genoma umano DB SNP built 128 (23 Oct 2007) Totale Totale codificanti Codificanti sinonimi Codificanti nonsinonimi

35 Aploblocchi sul sito

36 bovinesnp50 beadchip caninesnp20 beadchip equinesnp50 beadchip ovinesnp50 beadchip porcinesnp60 beadchip

37

38 Ridging una caratteristica banda dorsale di follicoli piliferi anormalmente orientati da cui prende nome il Rhodesian Ridgeback

39 Tra razze differenti di cani gli aploblocchi sono relativamente piccoli

40 Se lo stesso gene causa un fenotipo simile in razze differenti, unanalisi a due fasi è in grado di fornire la localizzazione cromosomica Il ridging è causato da una duplicazione di 133-kb che comprende tre geni fibroblast growth factors (FGFs)

41

42 distonia muscolare congenita (CMD) I vitelli con CMD presentano episodi di contratture muscolari generalizzati con due distinti fenotipi clinici (CMD1 and CMD2) I vitelli con CMD1 mostrano difficoltà nella deglutizione, affaticamento allesercizio, e miotonia muscolare che produce limpossibilità a flettere gli arti con conseguenti ferite dovute alle cadute I vitelli con CMD1 muoiono di solito entro poche settimane in conseguenza di complicazioni respiratorie I vitelli con CMD2 hanno miocloni in seguito a stimolazioni tattili od acustiche e muoiono tipcamente entro poche ore dalla nascita La causa della CMD2 è una mutazione di stop nel gene della subunità alfa1 dell inhibitory glycine receptor

43 Mappaggio della distonia muscolare congenita (CMD1) al cromosoma 25 utilizzando 12 bovini affetti e 14 controlli

44 Mutazione missenso R559C nellesone 14 del gene ATP2A1, (SERCA1) che serve a pompare il Ca2+ a ritroso dal cytosol verso il reticolo sarcoplasmatico, consentendo il rilassamento muscolare Mutazioni di stop del gene umano ATP2A1 gene causano la miopatia di Brody (OMIM ), una rara malattia autosomica recessiva con crampi indotti dallesercizio e impossibilità a rilassare i muscoli

45 Variazioni del genoma SSR Short Sequence Repeats ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CACACACACACACACACACACACACA CCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACAC AGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CACACACACACACACACACACACACACACACA CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCT AGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGAC ACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC Allele 1 Allele 2 ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CACACACACACACA CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATAT AGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTG ACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATA Allele 3

46 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA

47 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACTATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCG ACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTA GCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAG CTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCC GACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCG ACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACA CACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCT CGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTC CTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACA GATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCT CGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATA TATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAG ATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACAC CGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAG CTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTG AAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGA CCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGA 1 2 CNV= Copy Number Variation 10% del genoma umano

48

49 fenotipo Livello di espressione Ipotesi sulla variabilità del fenotipo di 6 individui diversi in caso di trisomia 21 in presenza di varianti alleliche


Scaricare ppt "Lo studio del genoma umano aiuta lo studio degli altri genomi Vincenzo Nigro Dipartimento di patologia generale, Seconda Università degli Studi di Napoli."

Presentazioni simili


Annunci Google