La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Analisi di linkage Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine.

Presentazioni simili


Presentazione sul tema: "Analisi di linkage Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine."— Transcript della presentazione:

1 Analisi di linkage Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM)

2 Trasmissione Autosomica Dominante Aaaa Aa aa un genitore Aa AA Aa aa entrambi i genitori 50% dei figli manifestano il carattere senza preferenza di sesso 75% dei figli manifestano il carattere senza preferenza di sesso A allele patologico dominante a allele normale recessivo Aa a a AA a a Genotipi: Genotipi: 1/2 Aa, 1/2 aa Fenotipi: Fenotipi: 1/2 affetti, 1/2 non affetti Genotipi: Genotipi: 1/4 AA, 1/2 Aa, 1/4 aa Fenotipi: Fenotipi: 3/4 affetti, 1/4 non affetti

3 Espressività Variabile Espressività: grado con il quale la malattia è espressa in un individuo Il tipo e la gravità delle manifestazioni cliniche non sono sempre sovrapponibili negli individui affetti dalla stessa patologia A.D. VARIABILITA INTERFAMILIARE o INTRAFAMILIARE Importanza di un accurato esame clinico esteso ai consanguinei di un affetto, anche apparentemente sani Nei figli di soggetti moderatamente affetti la patologia può essere più grave (es. Sclerosi tuberosa)

4 SINDROME: Un insieme di segni clinici apparentemente non collegati, ma che si osservano contemporaneamente nei pazienti, così di frequente da essere riconosciuti come ununica patologia e tipica dei fenotipi dominanti, anche se la recessivita potrebbe essere interpretata come un effetto della espressivita variabile il gene a meno che non sia deleto o completamente inattivato, a livello molecolare e sempre dominante: il problema e avere i mezzi per vederlo al livello di popolazione un fenotipo presenta espressivita variabile quando allinterno dellinsieme di soggetti sicuramente portatori il fenotipo presenta gravita e/o complessita diversa. Anche allinterno della famiglia ci puo essere espressivita variabile Espressivita variabile

5 SINDROME DI WAARDENBURG Sindrome completa: sordita + occhi di colore diverso + ciuffo di capelli bianchi sulla fronte + precoce incanutimento 1 sordita 2 sordita+ occhi di colore diverso 3 sordita+ occhi di colore diverso + ciuffo di capelli bianchi sulla fronte 4 ciuffo di capelli bianchi sulla fronte + precoce incanutimento Espressivita variabile

6 Il fenotipo puo comparire in eta avanzata Il fenotipo non e congenito pur essendo ereditario CONGENITO : presente alla nascita Dal punto di vista genetico raramente questi fenotipi sono dovuti a nuove mutazioni A livello di popolazione lallele mutato puo essere frequente purche l insorgenza si verifichi dopo linizio delleta riproduttiva e non limiti la fitness FITNESS: IDONEITA BIOLOGICA, piu semplicemente : capacita di riprodursi Trasmissione Autosomica Dominante Esordio variabile

7 Trasmissione Autosomica Dominante Penetranza Incompleta Penetranza: proporzione di individui portatori del gene patologico che hanno segni clinici della malattia Può dipendere: accuratezza diagnostica (esami clinici e di laboratorio mirati - es. porfiria acuta) età età (esordio variabile - es.Corea di Huntington) meccanismo dazione del gene (Retinoblastoma, teoria dei 2 hits di Knudson)

8 Sapere che un gene puo non essere completamente penetrante, e critico per studiarne la genetica o fornire consulenza genetica: un certo soggetto che non manifesta il carattere puo essere portatore del gene. La penetranza e quindi un concetto che si riferisce alla popolazione. A livello del singolo individuo il carattere ha solo due possibilita : si manifesta o non si manifesta. E piu frequente nei caratteri dominanti E critico percio il livello di indagine Penetranza

9 Età di insorgenza della Corea di Huntington a)Probabilità che un individuo portatore del gene mutato abbia sviluppato i sintomi ad una data età b)Rischio che il figlio sano di un soggetto affetto sia portatore del gene mutato ad una determinata età.

10 Lespressivita e il grado di gravitacon cui fra gli individui che presentano il fenotipo questo si esprime: puo costituire un sottoinsieme degli individui penetranti La penetranza ridotta non e da confondere con lespressivita variabile Es. Neurofibromatosi: presenza di tumori lungo i nervi periferici e regioni di pigmentazione scura (macchie di caffelatte)Tutti i portatori presentano almeno uno dei segni, ma la gravita puo essere diversa anche allinterno della stessa famiglia: un genitore con macchie e piccoli tumori cutanei benigni puo avere un figlio che presenta tumori estesi e maligni. (questa differenza non e prevedibile si puo solo quantizzare il rischio di ereditare lallele non il fenotipo) Penetranza ed espressivita

11 ipotesi sul rischio di ricorrenza 1.La malattia non è genetica 2.La malattia è dovuta a nuova mutazione dominante: rischi di ricorrenza trascurabili nella prole della coppia 3.La trasmissione è autosomica recessiva: rischio di ricorrenza di 1 su 4 per la futura prole indipendentemente dal sesso 4.La malattia è legata allX recessiva e la madre può essere o meno portatrice: rischio di ricorrenza di 1 su 2 maschi se la madre è portatrice 5.La malattia è poligenica o cromosomica: rischio di ricorrenza ben definito dipendente dal tipo di malattia

12 mappaggio genico Serve ad identificare la posizione cromosomica di un locus genico Possono essere mappati: –marcatori genetici anonimi, quali brevi sequenze di DNA (dette STS), DNA microsatelliti, ecc. –geni –loci associati a malattie con trasmissione mendeliana –loci associati a predisposizione a malattie con trasmissione nonmendeliana

13 a cosa serve il mappaggio in genetica medica? –per identificare la localizzazione dei geni malattia –per fare diagnosi indiretta in una famiglia in cui la mutazione responsabile di una malattia genetica mendeliana non è stata ancora identificata –per identificare i geni responsabili della suscettibilità a malattie non mendeliane

14 per localizzare e identificare geni malattia Linkage mapping

15 per fare diagnosi indiretta in una famiglia in cui la mutazione responsabile di una malattia genetica mendeliana non è stata ancora identificata

16 per identificare i geni associati ad una suscettibilità a malattie non mendeliane

17 Segregazione e crossing-over un figlio riceve un cromosoma da ciascun genitore che è il prodotto finale della ricombinazione meiotica Non è possibile ricevere un cromosoma che non abbia effettuato crossing-over

18 principi generali del mappaggio si segue la segregazione della patologia nei pedigrees utilizzando marcatori genetici a posizione nota si correla la segregazione della patologia e dei marcatori in più famiglie quanto più spesso la patologia e un marcatore co-segregano tanto più sono vicini * * * * * *

19 cè bisogno di famiglie abbastanza grandi in cui si osserva la trasmissione della patologia

20 i membri della famiglia devono essere genotipizzati usando marcatori polimorfici marcatori polimorfici sono noti per ogni cromosoma e di ciascuno si conosce esattamente la posizione cromosomica i marcatori più informativi sono quelli che presentano un elevato grado di eterozigosità, perché questo consente di distinguere lallele paterno dallallele materno La nomenclatura D20S906 indica che un marcatore di DNA è singolo nel genoma ed è localizzato sul cromosoma 20; purtroppo il numero 906 non ha alcun rapporto con la posizione

21 Marcatori polimorfici A partire dagli anni 80 RFLP: restriction fragment length polymorphisms Nella accezione attuale, il DNA purificato è amplificato con la PCR. Il prodotto della PCR è quindi tagliato in frammenti di restrizione mediante enzimi di restrizione detti endonucleasi, che attuano il taglio unicamente in corrispondenza di particolari sequenze nucleotidiche, specifiche per ogni enzima. I frammenti di restrizione sono separati per lunghezza mediante elettroforesi su gel d'agarosio

22 RFLP lenzima di restrizione SmaI taglia lesanucleotide CCCGGG. La sequenza CCGGGG rende non digeribile il DNA in quella posizione

23 STR A partire dal 1990 STR: short-tandem repeats or microsatellites –e.g. (CA n ) –gttatcttagggctcagtcacacacacacacacacacacatccaggtattggatcaac Quello che varia tra gli alleli è il numero di ripetizioni dellelemento. E molto più frequente riscontrare individui eterozigoti, con un numero di ripetizioni differente nei due alleli

24 ricombinanti R e non ricombinanti NR il 50% deve essere R e il 50% NR se i loci sono posti su cromosomi differenti, mentre i NR sono >50% se i loci sono sintenici.

25 Lanalisi della frazione di ricombinazione è alla base del mappaggio la frazione di ricombinazione tra due loci,, è compresa tra 0 e 0.5 Il valore di non può mai essere maggiore di 0.5, il che indica che i loci sono posizionati molto lontani o su cromosomi differenti se è significativamente minore di 0.5 i loci sono linked più piccolo è più vicini sono i loci

26

27 lunità di misura della distanza genetica è il centiMorgan cM La distanza genetica tra due loci è il numero atteso di crossovers per meiosi l le distanze piccole sono accurate mentre le grandi sono sottostimate perché un doppio crossover può far pensare a un non ricombinante l per valutare distanze grandi occorre sommare distanze piccole l per q <10% la correlazione tra q e cM è 1:1 l mediamente 1 cM corrisponde a circa bp, ma tale valore è inversamente proporzionale alla frequenza di ricombinazione

28 Le meiosi si visualizzano con MLH1 che è parte del macchinario di ricombinazione Nella meiosi maschile che avviene nei testicoli ci sono circa 51 chiasmi e quindi considerando 50cM per chiasma, il genoma è di 2550 cM Nella meiosi femminile che è più difficile da studiare perché avviene a settimane di vita fetale ci sono almeno 70 chiasmi (3500 cM), ma si stimano 4280cM Dal momento che la frequenza di ricombinazione è differente si usa un valore medio tra i due sessi

29 Il mappaggio per linkage è basato sullanalisi della ricombinazione d D d d = affetto = non affetto D = allele patologico d = allele wild-type Locus malattia Marker

30 d D d d Doppio eterozigote 1° obiettivo - stabilire la fase

31 d D d d NR NR NR NR NR R recombinanti = 1/5 2° obiettivo – contare i ricombinanti

32 lod-score Il lod-score misura le probabilità a favore del linkage Compara la probabilità ad un certo valore di e la probabilità nel caso non vi sia alcun linkage e quindi che sia uguale a 0.5 LOD = log of the oddsZ( ) = log 10 [L( )/L(0.5)]

33 d D d d NR NR NR NR NR R Z = log 10 R ( 1- ) NR 0.5 (R+NR) LOD SCORE (LOD) = log 10 ( 1- ) ° obiettivo – calcolare il LOD score

34 Il metodo La probabilità L( ) è calcolata per i differenti valori di tra 0 e 0.5 Un rapporto tra le probabilità è calcolato LR( ) = L( )/L(0.50) Il lod-score è il logaritmo in base 10 log 10 del rapporto tra le probabilità Z( ) = log 10 [L( )/L(0.50)] La migliore stima della frazione di ricombinazione è il valore di a cui Z( ) è massimo (MLS)

35 Per le patologie a trasmissione mendeliana Z( ) >> 3 si accetti il linkage per un carattere autosomico Z( ) >>2 si accetti il linkage per un carattere X-linked Z ( ) < -2 si respinga definitivamente lipotesi di linkage per un particolare valore di Z( ) > -2 ma < 3 occorrono ulteriori studi

36 linked, no recombination

37 Link utile


Scaricare ppt "Analisi di linkage Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine."

Presentazioni simili


Annunci Google