La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

LE ARANCE DELLA SALUTE 31 Gennaio 2009 LE ARANCE DELLA SALUTE 31 Gennaio 2009 SSOCIAZIONE TALIANA per la ICERCA sul ANCRO.

Presentazioni simili


Presentazione sul tema: "LE ARANCE DELLA SALUTE 31 Gennaio 2009 LE ARANCE DELLA SALUTE 31 Gennaio 2009 SSOCIAZIONE TALIANA per la ICERCA sul ANCRO."— Transcript della presentazione:

1

2 LE ARANCE DELLA SALUTE 31 Gennaio 2009 LE ARANCE DELLA SALUTE 31 Gennaio 2009 SSOCIAZIONE TALIANA per la ICERCA sul ANCRO

3

4 Neoplasia dal greco neos nuovo e plassein costruire nuova crescita Tumore dal latino tumor originariamente qualsiasi tipo di tumefazione tumorale; ora sinonimo di neoplasia Una neoplasia e una massa anomala di tessuto, la cui proliferazione cellulare non e soggetta ai normali meccanismi di crescita, si comporta in modo afinalistico ed e virtualmente autonoma Cancro dal latino cancer granchio, usato comunemente per indicare tutti i tumori maligni

5 Il cancro rappresenta in tutto il mondo una delle maggiori cause di morte Ogni anno nel mondo si ammalano circa 8 milioni di persone La cifra annuale di nuovi casi di tumore e in continuo aumento (WHO)

6 Malattie del sistema cardiocircolatorio 43% Suicidi ed incidenti 5% Altre cause 20% Cancro 26% Malattie del sistema respiratorio 6% Dati di mortalita: Unione Europea

7 % di tutte le morti per tumore Percentuali di morti da tumore attribuibili a vari differenti fattori ( da Doll e Peto, J.Natl.Cancer Inst., 1981) Fattori Range di stima più probabile Alimentazione35% Tabacco30% Inattività fisica 12% Additivi alimentari >1% Attività riproduttiva e sessuale 7% Attività lavorativa 4% Inquinamento (aria, acqua, cibo) 2 % Prodotti industriali > 1 Farmaci e interventi sanitari 1% Fattori geofisici (radiazioni ionizzanti ed ultraviolette) 3% Infezioni10?% Sconosciuti?

8

9 nucleo cellul a cromosoma telomero centromero istoni Paia di basi (A, T, G, C) DNA a doppia elica

10

11 ….. ATAAATTTTTAAACAACCCAAAATGCGTTCCAT ATAAAGAAATGGCAAGTTATTTAGCTATCAAGATT TTACATGTAGTTTTCTTATAACTTTTTTGTACAAT TGCATAGACGTGTAAAACCTGCCATTGTTAACAAA ACAATAACAGACTTAGAAACTACTGAAATCTACAG TATAATACCACTACCCTTCACAAAAATATAGATTT ATTTCTTGTAAACTCTTACTGTCTAATCCTCTTTG TTGTATGAATATTATAAAAACCATGCGGGAATCAG GAGTTGTAAAACATTTATTCTGCTCCTTCTTCATC TGTCATGACTGATACTAAGGACTCCATCGCTCTGCC CAAATCATCTGCCATGT …………

12 Genoma umano: di paia di basi che si replicano ad ogni divisione cellulare A T C G …A T G G T A C A T C C A G G… …T A C C A T G T A G G T C C…

13 Genoma umano: pb

14 Geni umani: circa

15 Geni coinvolti nei tumori: circa 300

16 Replicazione in provetta: 1 errore ogni paia di basi In vivo nell'uomo: 1/ paia di basi mutazioni

17 Ci sono voluti centinaia di milioni di anni per mettere a punto un equilibrio, sempre delicato, con lambiente in cui viviamo. Siamo molto ben equipaggiati per far fronte ai numerosi insulti che ci arrivano continuamente dallambiante

18 Meccanismi di: protezione del DNA riparo del DNA prevenzione della trasmissione del danno (apoptosi) (Virus HIV: varia > uomo)

19 Carcinogenesi Danni ripetuti e molteplici che colpiscono la cellula, se la cellula non è in grado di riparare il danno può insorgere un tumore maligno Interazioni complesse tra agenti cancerogeni, suscettibilità individuale e diminuzione delle difese organiche

20 Cariotipo normale

21 Cariotipo riarrangiato

22

23 MUTAZIONI PRIMARIE: importanti per linsorgenza di un tumore MUTAZIONI SECONDARIE: importanti per la progressione tumorale

24 Mutazioni genetiche Displasia Carcinoma in situ Carcinoma invasivo Carcinoma metastatizzante Processo multifasico

25 Le terapie dei tumori sono spesso non specifiche: inibiscono la proliferazione cellulare

26 il nostro genoma e' complesso la cura ottimale: quella specifica per ogni tumore Perche' la ricerca e complessa e costosa?

27 Si puo sconfiggere il cancro? Probabilmente NO, ma si puo imperdire che uccida

28 Tra fine 800 e inizio 900 la chirurgia era la principale cura per molte forme neoplastiche. Dal primo 900, essa è affiancata da radioterapia, mentre negli anni 40 viene impiegata anche la chemioterapia. Dallinizio del 900 la patologia neoplastica ha iniziato unespansione che lha portata, sin da metà degli anni 30, ad essere definita il male del secolo. Negli anni sono identificati i fattori di rischio ambientali ed alimentari, e si effettuano perciò programmi di prevenzione primaria.

29 Dal 2000 grazie progressi della biologia molecolare tra cui il sequenziamento del genoma umano, si stanno definendo i fattori biologici, immunologici e genetici che predispongono al tumore. Ad oggi sono in atto ricerche per migliorare le terapie consuete, mentre sono in fase sperimentale nuove promettenti terapie come limmunoterapia e la Terapia Genica. Negli anni 90 con il miglioramento delle tecniche diagnostiche aumenta la possibilità di una diagnosi tempestiva e precoce.

30 Il cancro, diversamente dal passato, è diventato oggi una patologia spesso curabile: - la guaribilità per alcuni tipi di tumore (melanoma, utero, mammella) arriva al 70%, - quella di determinate forme (colon retto, leucemie, testicolo, neoplasie infantili) arriva al 40-50%, - purtroppo altri (pancreas, polmone, stomaco) restano ancora poco sensibili alle terapie. Ciò è dovuto agli effetti congiunti di programmi di prevenzione e diagnosi precoce, oltre a un effettivo miglioramento delle terapie.

31 M.C. Guastadisegni Dipartimento di Genetica e Microbiologia-Universita di Bari

32

33 LA PREVENZIONE E NELLE NOSTRE MANI PRIMARIA E POSSIBILE DIMINUIRE IL RISCHIO DI AMMALARSI SECONDARIA DIAGNOSI PRECOCE TERZIARIA CONTROLLI SUCESSIVI ALLE GUARIGIONI

34 PREVENZIONE E DIAGNOSI PRECOCE 1.CAVO ORALE 2.CERVICE UTERINA 3.COLON-RETTO 4.CUTE 5.ENDOMETRIO 6.MAMMELLA 7.POLMONE 8.PROSTATA 9.TESTICOLO Le localizzazioni del cancro dove è possibile fare prevenzione e diagnosi precoce

35 MANGIA PIU FRUTTA E VERDURA FRESCA FA MOVIMENTO NON INQUINARE LAMBIENTE AL SOLE MA NON TROPPO NON FUMARE LIMITA LE BEVANDE ALCOLICHE

36 TUMORE AL POLMONE MALATTIE DEL SISTEMA RESPIRATORIO TUMORE DEL CAVO ORALE, DELLA LARINGE E FARINGE TUMORE DELL ESOFAGO TUMORE ALLA VESCICA Meglio non cominciare mai!!! E per smettere, non e mai troppo tardi (ne troppo presto!)

37 IL FUMO Miscela eterogenea di oltre 4000 sostanze gassose e corpuscolari, originate dal processo di combustione delle foglie di tabacco Le più dannose per lorganismo: NICOTINA (responsabile della dipendenza) MONOSSIDO DI CARBONIO SOSTANZE IRRITANTI ED OSSIDANTI BENZOPIRENE E ALTRE SOSTANZE CANCEROGENE Leffetto del fumo è sinergico con altri fattori (es. inquinamento atmosferico) Il danno è tanto più grave quanto più alto è il numero delle sigarette fumate e quanto più giovane letà di inizio dellabitudine tabagica

38 INTESTINO SENO 2 BICCHIERI DI VINO AL GIORNO 1-1½ BICCHIERI DI VINO AL GIORNO I RAGAZZI NON METABOLIZZANO LALCOL!!! NON BEVETENE MAI! E negli adulti IL CONSUMO DI ALCOL (ANCHE SE BASSO) PUO FAVORIRE LINSORGENZA DI ALCUNI TUMORI EVITARE I SUPERALCOLICI

39 MASSIMA PROTEZIONE PER TUTTO IL TEMPO DI ESPOSIZIONE !!! PRIVILEGIARE LE PRIME ORE DEL MATTINO SCOTTATURE INVECCHIAMENTO PRECOCE DELLA PELLE MELANOMI

40 AIUTA A MANTENERE IL PESO CORPOREO ELIMINA LE SOSTANZE TOSSICHE RAFFORZA I MUSCOLI E GLI ALTRI TESSUTI DEL NOSTRO CORPO TUMORE OBESITA MALATTIE CARDIOVASCOLARI OSTEOPOROSI RIDUCE IL RISCHIO DI ALCUNE MALATTIE :

41 INFARTO DIABETE OBESITA CANCRO DEL COLON E DELLO STOMACO CANCRO AL SENO

42 COSA INFLUENZA IL NOSTRO MODO DI MANGIARE? IL GUSTO LE STAGIONI LORARIO IL PAESE IN CUI VIVIAMO ABITUDINI ALIMENTARI

43

44

45

46

47 GRASSI PROTEINE CARBOIDRATI VITAMINE ACQUA MINERALI

48 SERVE A MANTENERE COSTANTE LA TEMPERATURA CORPOREA TRASPORTA I PRINCIPI NUTRITIVI IN TUTTI I PUNTI DEL CORPO PERMETTE DI ELIMINARE LE SOSTANZE CHE NON CI SERVONO DOVE? BEVANDECIBO

49 DOVE SONO? - POCA FORZA DIVENTI MENO ALTO TI DIFENDI MENO BENE DALLE MALATTIE COSTRINGI AD UN SUPERLAVORO IL TUO FEGATO ED I RENI + QUANTE NE SERVONO?

50 FORNISCONO RAPIDAMENTE ENERGIA AL NOSTRO ORGANISMO CARIE SEI ASSONNATO INGRASSI PIU FACILMENTE RISCHIO DI AMMALARTI + TI STANCHI PRIMA RENDI MENO SIA A SCUOLA CHE NELLO SPORT - QUANTI NE SERVONO? MUSCOLICERVELLO

51 SONO UN LUBRIFICANTE PER LE ARTICOLAZIONI FONTE DI ENERGIA STENDONO UN VELO SOTTILE SULLA PELLE PERMETTONO DI ASSIMILARE ALCUNE IMPORTANTI VITAMINE FANNO INGRASSARE DOVE SONO? CARNE SALUMI LATTE FORMAGGI PESCE

52 FERRO IODIO MAGNESIO CALCIO POTASSIO

53 SERVONO PER LA CRESCITA DELLE OSSA SERVONO PER LA CRESCITA DEI DENTI E DEI CAPELLI SERVONO PER IL FUNZIONAMENTO DEGLI OCCHI E DEL SISTEMA NERVOSO CI DIFENDONO DALLE MALATTIE DOVE SONO?

54 MANGIA ALMENO 3 PORZIONI DI VERDURA E 2 DI FRUTTA AL GIORNO FA ATTIVITA FISICA MANGIA PIU CIBI INTEGRALI E LEGUMI: SONO RICCHI DI FIBRE NON MANGIARE SEMPRE LE STESSE COSE, METTI NEL PIATTO CIBI DIVERSI TROPPI GRASSI SONO DANNOSI (SPECIE SE NASCOSTI TRA DOLCIUMI E FRITTI). LOLIO DOLIVA E UNO DEI CONDIMENTI PIUSANI, NON ESAGERARE. MANGIA PESCE ALMENO 2 VOLTE ALLA SETTIMANA NON MANGIARE SPESSO CIBI TROPPO SALATI QUANDO HAI SETE BEVI LACQUA, RIDUCI LE BIBITE DOLCI

55 VITAMINA C VITAMINA B1 VITAMINA B2 VITAMINA PP ANTIOSSIDANTI SALI MINERALI FIBRE ENERGIA

56

57

58 Il 31 gennaio la vitamina C sostiene la ricerca. AIUTALA ANCHE TU.

59 LAIRC è una Associazione libera senza fini di lucro, che promuove la raccolta fondi da destinare alla ricerca sul cancro in Italia, e la diffusione delle informazioni sullo stato della ricerca e sui suoi progressi. LAssociazione si è progressivamente ampliata, ed oggi può contare sulla presenza di 17 Comitati Regionali e quasi 2 milioni di soci. LAssociazione Italiana per la Ricerca sul Cancro è stata fondata nel 1965, grazie alliniziativa di alcuni ricercatori dellIstituto dei Tumori di Milano, fra cui il Prof. Umberto Veronesi. LAIRC, insieme a FIRC, costituisce il principale polo privato non profit di finanziamento della ricerca sul cancro in Italia, coprendo circa il 50% della spesa globale destinata a questo scopo nel Paese. La raccolta fondi nel corso dell 2007 ha raggiunto un totale di 56 milioni, ed ogni anno può contare una crescita del 2%.

60 GESTIONE DEI FONDI Vi è un Comitato Tecnico Scientifico, composto da 24 membri, e circa 250 Revisori Stranieri arruolati al servizio di AIRC. Ognuno valuta fino ad massimo di 10 progetti. Ogni progetto viene valutato contemporaneamente da 2 revisori stranieri e da 2 membri del Comitato. Nel 2007 sono stati finanziati 446 progetti di ricerca a fronte di 802 richieste per un importo totale di 31 milioni. Oltre a questi, sono state finanziate: 5 unità di ricerca autonome, dirette da giovani ricercatori, fondate grazie a fondi AIRC e finanziate per un periodo di 5 anni; Progetti regionali , deliberati 6 milioni per il nuovo ciclo. 11 progetti per giovani ricercatori chiamati My First AIRC Grant, bandite per la prima volta nel 2007; Borse di Studio triennali per la formazione alla ricerca oncologica di giovani ricercatori;

61

62


Scaricare ppt "LE ARANCE DELLA SALUTE 31 Gennaio 2009 LE ARANCE DELLA SALUTE 31 Gennaio 2009 SSOCIAZIONE TALIANA per la ICERCA sul ANCRO."

Presentazioni simili


Annunci Google